Incidental Mutation 'R6996:Or5h22'
ID 544247
Institutional Source Beutler Lab
Gene Symbol Or5h22
Ensembl Gene ENSMUSG00000064006
Gene Name olfactory receptor family 5 subfamily H member 22
Synonyms GA_x54KRFPKG5P-55303207-55302284, Olfr190, MOR183-4
MMRRC Submission 045102-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.061) question?
Stock # R6996 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 58894518-58895441 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 58894555 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 296 (M296T)
Ref Sequence ENSEMBL: ENSMUSP00000148991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071243] [ENSMUST00000215687] [ENSMUST00000216495]
AlphaFold K7N5T5
Predicted Effect probably benign
Transcript: ENSMUST00000071243
AA Change: M296T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000071224
Gene: ENSMUSG00000064006
AA Change: M296T

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.1e-46 PFAM
Pfam:7tm_1 39 288 2.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215687
AA Change: M296T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000216495
AA Change: M296T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 G A 8: 25,296,517 (GRCm39) S310L probably damaging Het
Adamts16 C T 13: 70,946,157 (GRCm39) probably null Het
Arrb1 C A 7: 99,240,569 (GRCm39) D194E probably benign Het
Atp1a3 T C 7: 24,697,051 (GRCm39) D217G probably damaging Het
Bcar3 A G 3: 122,302,033 (GRCm39) I123V possibly damaging Het
Bdp1 G A 13: 100,180,321 (GRCm39) L1833F probably damaging Het
Cdc14a T C 3: 116,122,355 (GRCm39) Y155C probably damaging Het
Cdo1 C A 18: 46,853,380 (GRCm39) R126M possibly damaging Het
Cfap99 G T 5: 34,484,604 (GRCm39) R627L probably damaging Het
Efr3a T A 15: 65,720,030 (GRCm39) L369* probably null Het
Erich6 A C 3: 58,543,516 (GRCm39) F185V probably damaging Het
Fam186a T C 15: 99,853,374 (GRCm39) D122G unknown Het
Fank1 A G 7: 133,478,627 (GRCm39) I230M possibly damaging Het
Flg2 A T 3: 93,109,977 (GRCm39) E668D unknown Het
Flg2 A C 3: 93,110,256 (GRCm39) R761S unknown Het
Gabrr1 T C 4: 33,158,157 (GRCm39) L260P probably damaging Het
Gfm2 G A 13: 97,285,868 (GRCm39) R119K probably damaging Het
Gm14226 A G 2: 154,866,357 (GRCm39) T105A probably benign Het
Gm14496 A G 2: 181,637,997 (GRCm39) N357S probably damaging Het
Gm5916 G A 9: 36,039,935 (GRCm39) L18F probably benign Het
Golm1 A T 13: 59,790,058 (GRCm39) N247K probably benign Het
Gpatch2l G A 12: 86,290,958 (GRCm39) R47H probably damaging Het
Greb1 C T 12: 16,773,355 (GRCm39) A240T probably benign Het
Gtf3c6 T C 10: 40,125,774 (GRCm39) M148V probably benign Het
Guca1a T C 17: 47,706,102 (GRCm39) S126G probably benign Het
Hacl1 A T 14: 31,337,380 (GRCm39) I393N possibly damaging Het
Hddc3 A G 7: 79,993,498 (GRCm39) D68G possibly damaging Het
Hsfy2 T C 1: 56,675,569 (GRCm39) T323A possibly damaging Het
Kcng2 T C 18: 80,366,358 (GRCm39) probably benign Het
Kdm2a G T 19: 4,395,669 (GRCm39) P321T probably benign Het
Krt31 A G 11: 99,938,558 (GRCm39) V345A probably benign Het
Lrrc37 A T 11: 103,509,583 (GRCm39) L795* probably null Het
Mettl1 T C 10: 126,880,887 (GRCm39) S193P probably benign Het
Mme G A 3: 63,253,523 (GRCm39) D456N possibly damaging Het
Mmrn1 A G 6: 60,954,367 (GRCm39) T883A probably benign Het
Mphosph10 C G 7: 64,038,669 (GRCm39) E293Q probably benign Het
Muc16 C A 9: 18,557,193 (GRCm39) K3033N unknown Het
Myo16 C T 8: 10,619,496 (GRCm39) T1349M probably damaging Het
Myo5c T C 9: 75,157,746 (GRCm39) I233T probably benign Het
Or4p4b-ps1 A G 2: 88,454,189 (GRCm39) T181A unknown Het
Or52a33 T G 7: 103,289,065 (GRCm39) N94T probably benign Het
Or52ac1 A T 7: 104,246,018 (GRCm39) F123L probably benign Het
Or5b111 A T 19: 13,291,036 (GRCm39) S204R probably benign Het
Or6c2 T A 10: 129,362,732 (GRCm39) V212E probably damaging Het
Or7c70 C A 10: 78,683,351 (GRCm39) V133L probably benign Het
Oxct2b A G 4: 123,011,480 (GRCm39) I467V probably benign Het
Parp1 A T 1: 180,414,936 (GRCm39) N425Y possibly damaging Het
Pcdhgc3 T A 18: 37,939,656 (GRCm39) V19D possibly damaging Het
Pfkl T A 10: 77,833,423 (GRCm39) I260F probably damaging Het
Pkd1l1 C T 11: 8,799,046 (GRCm39) G1789R probably damaging Het
Pla1a G A 16: 38,217,830 (GRCm39) A386V probably benign Het
Pml A G 9: 58,142,169 (GRCm39) L221P probably damaging Het
Rcn2 C T 9: 55,964,845 (GRCm39) Q268* probably null Het
Reps1 T A 10: 17,969,603 (GRCm39) D235E probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,229,118 (GRCm39) probably benign Het
Sap30bp A G 11: 115,824,314 (GRCm39) probably benign Het
Scn1a A T 2: 66,118,075 (GRCm39) S1433T probably damaging Het
Sde2 T C 1: 180,678,754 (GRCm39) V6A probably benign Het
Sdk1 C A 5: 142,197,769 (GRCm39) R2141S probably benign Het
Setd2 T C 9: 110,379,640 (GRCm39) S1152P probably damaging Het
Slc26a2 C T 18: 61,334,926 (GRCm39) V176I probably damaging Het
Snx7 A G 3: 117,640,281 (GRCm39) I76T possibly damaging Het
Specc1l C A 10: 75,082,113 (GRCm39) A520D probably benign Het
Spop A G 11: 95,362,136 (GRCm39) T56A possibly damaging Het
Syne2 T A 12: 76,074,786 (GRCm39) D4576E probably damaging Het
Tas2r134 A C 2: 51,517,601 (GRCm39) M27L probably benign Het
Tecta A C 9: 42,278,082 (GRCm39) I1142S probably benign Het
Timm44 T C 8: 4,316,611 (GRCm39) D311G possibly damaging Het
Tmem123 C G 9: 7,791,071 (GRCm39) T124R possibly damaging Het
Tmem184b A T 15: 79,246,959 (GRCm39) L370Q probably benign Het
Trim25 T A 11: 88,890,329 (GRCm39) N5K probably benign Het
Vmn2r93 A G 17: 18,524,903 (GRCm39) Y187C probably damaging Het
Vpreb1a A G 16: 16,686,678 (GRCm39) Y71H probably damaging Het
Vpreb1b T C 16: 17,798,441 (GRCm39) S5P probably benign Het
Xpo7 A T 14: 70,906,888 (GRCm39) C939S probably benign Het
Zfp78 C A 7: 6,381,764 (GRCm39) S271R probably benign Het
Zic5 A T 14: 122,702,080 (GRCm39) M217K probably benign Het
Other mutations in Or5h22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Or5h22 APN 16 58,895,052 (GRCm39) nonsense probably null
IGL01011:Or5h22 APN 16 58,894,793 (GRCm39) missense probably benign 0.10
IGL01453:Or5h22 APN 16 58,895,132 (GRCm39) missense probably benign 0.00
IGL01978:Or5h22 APN 16 58,894,630 (GRCm39) missense probably benign 0.33
IGL02348:Or5h22 APN 16 58,895,312 (GRCm39) missense probably damaging 0.99
IGL02423:Or5h22 APN 16 58,894,630 (GRCm39) missense probably benign 0.33
IGL02628:Or5h22 APN 16 58,895,155 (GRCm39) missense probably benign 0.01
R0220:Or5h22 UTSW 16 58,895,095 (GRCm39) missense probably damaging 1.00
R0471:Or5h22 UTSW 16 58,894,633 (GRCm39) missense probably benign 0.01
R1697:Or5h22 UTSW 16 58,895,270 (GRCm39) missense probably damaging 1.00
R3009:Or5h22 UTSW 16 58,895,350 (GRCm39) missense probably benign 0.01
R3011:Or5h22 UTSW 16 58,895,350 (GRCm39) missense probably benign 0.01
R3027:Or5h22 UTSW 16 58,895,330 (GRCm39) missense probably benign 0.00
R4080:Or5h22 UTSW 16 58,894,619 (GRCm39) missense probably damaging 0.96
R4482:Or5h22 UTSW 16 58,895,286 (GRCm39) missense probably benign 0.02
R4895:Or5h22 UTSW 16 58,895,020 (GRCm39) missense probably benign 0.09
R5409:Or5h22 UTSW 16 58,894,559 (GRCm39) missense possibly damaging 0.94
R5825:Or5h22 UTSW 16 58,895,024 (GRCm39) missense probably benign 0.01
R6146:Or5h22 UTSW 16 58,895,077 (GRCm39) missense probably benign 0.05
R6249:Or5h22 UTSW 16 58,894,795 (GRCm39) missense probably damaging 1.00
R7283:Or5h22 UTSW 16 58,894,555 (GRCm39) missense probably benign
R7707:Or5h22 UTSW 16 58,894,634 (GRCm39) missense possibly damaging 0.52
R8381:Or5h22 UTSW 16 58,895,225 (GRCm39) missense probably damaging 1.00
R8507:Or5h22 UTSW 16 58,895,243 (GRCm39) missense possibly damaging 0.81
R8887:Or5h22 UTSW 16 58,894,846 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GCTGGGTATCAAAAGGCTTAAATAC -3'
(R):5'- GAAGGCTTTCTCTACCTGTGG -3'

Sequencing Primer
(F):5'- GGGGGCCATTTTTATTCAAATCACC -3'
(R):5'- GTGGTGCCCATCTCTTATCTGTG -3'
Posted On 2019-05-13