Incidental Mutation 'R6996:Guca1a'
ID544249
Institutional Source Beutler Lab
Gene Symbol Guca1a
Ensembl Gene ENSMUSG00000023982
Gene Nameguanylate cyclase activator 1a (retina)
SynonymsmGCAP1, Guca1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R6996 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location47394560-47400584 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 47395177 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 126 (S126G)
Ref Sequence ENSEMBL: ENSMUSP00000060027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024774] [ENSMUST00000059348] [ENSMUST00000145462]
Predicted Effect probably benign
Transcript: ENSMUST00000024774
SMART Domains Protein: ENSMUSP00000024774
Gene: ENSMUSG00000023979

DomainStartEndE-ValueType
EFh 57 85 6.35e-4 SMART
EFh 93 121 3.65e-4 SMART
EFh 146 174 5.83e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000059348
AA Change: S126G

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000060027
Gene: ENSMUSG00000023982
AA Change: S126G

DomainStartEndE-ValueType
EFh 55 83 3.01e-5 SMART
EFh 91 119 2.44e-5 SMART
EFh 135 163 5.83e-3 SMART
low complexity region 166 177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145462
SMART Domains Protein: ENSMUSP00000126799
Gene: ENSMUSG00000023979

DomainStartEndE-ValueType
EFh 57 85 6.35e-4 SMART
EFh 93 121 3.65e-4 SMART
low complexity region 180 190 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a calcium-binding photoreceptor protein. The encoded protein may be involved in modulation of guanylyl cyclase activity, and in turn, the mammalian cone phototransduction cascade. Disruption of this gene results in the retinal degeneration associated with cone dystrophy. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice heterozygous or homozygous for a knock-in allele exhibit photoreceptor degeneration and loss of cone and rod function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 G A 8: 24,806,501 S310L probably damaging Het
Adamts16 C T 13: 70,798,038 probably null Het
Arrb1 C A 7: 99,591,362 D194E probably benign Het
Atp1a3 T C 7: 24,997,626 D217G probably damaging Het
Bcar3 A G 3: 122,508,384 I123V possibly damaging Het
Bdp1 G A 13: 100,043,813 L1833F probably damaging Het
Cdc14a T C 3: 116,328,706 Y155C probably damaging Het
Cdo1 C A 18: 46,720,313 R126M possibly damaging Het
Cfap99 G T 5: 34,327,260 R627L probably damaging Het
Efr3a T A 15: 65,848,181 L369* probably null Het
Erich6 A C 3: 58,636,095 F185V probably damaging Het
Fam186a T C 15: 99,955,493 D122G unknown Het
Fank1 A G 7: 133,876,898 I230M possibly damaging Het
Flg2 A T 3: 93,202,670 E668D unknown Het
Flg2 A C 3: 93,202,949 R761S unknown Het
Gabrr1 T C 4: 33,158,157 L260P probably damaging Het
Gfm2 G A 13: 97,149,360 R119K probably damaging Het
Gm14226 A G 2: 155,024,437 T105A probably benign Het
Gm14496 A G 2: 181,996,204 N357S probably damaging Het
Gm5916 G A 9: 36,128,639 L18F probably benign Het
Gm884 A T 11: 103,618,757 L795* probably null Het
Golm1 A T 13: 59,642,244 N247K probably benign Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Greb1 C T 12: 16,723,354 A240T probably benign Het
Gtf3c6 T C 10: 40,249,778 M148V probably benign Het
Hacl1 A T 14: 31,615,423 I393N possibly damaging Het
Hddc3 A G 7: 80,343,750 D68G possibly damaging Het
Hsfy2 T C 1: 56,636,410 T323A possibly damaging Het
Kcng2 T C 18: 80,323,143 probably benign Het
Kdm2a G T 19: 4,345,641 P321T probably benign Het
Krt31 A G 11: 100,047,732 V345A probably benign Het
Mettl1 T C 10: 127,045,018 S193P probably benign Het
Mme G A 3: 63,346,102 D456N possibly damaging Het
Mmrn1 A G 6: 60,977,383 T883A probably benign Het
Mphosph10 C G 7: 64,388,921 E293Q probably benign Het
Muc16 C A 9: 18,645,897 K3033N unknown Het
Myo16 C T 8: 10,569,496 T1349M probably damaging Het
Myo5c T C 9: 75,250,464 I233T probably benign Het
Olfr1356 C A 10: 78,847,517 V133L probably benign Het
Olfr1465 A T 19: 13,313,672 S204R probably benign Het
Olfr190 A G 16: 59,074,192 M296T probably benign Het
Olfr475-ps1 A G 2: 88,623,845 T181A unknown Het
Olfr622 T G 7: 103,639,858 N94T probably benign Het
Olfr655 A T 7: 104,596,811 F123L probably benign Het
Olfr791 T A 10: 129,526,863 V212E probably damaging Het
Oxct2b A G 4: 123,117,687 I467V probably benign Het
Parp1 A T 1: 180,587,371 N425Y possibly damaging Het
Pcdhgc3 T A 18: 37,806,603 V19D possibly damaging Het
Pfkl T A 10: 77,997,589 I260F probably damaging Het
Pkd1l1 C T 11: 8,849,046 G1789R probably damaging Het
Pla1a G A 16: 38,397,468 A386V probably benign Het
Pml A G 9: 58,234,886 L221P probably damaging Het
Rcn2 C T 9: 56,057,561 Q268* probably null Het
Reps1 T A 10: 18,093,855 D235E probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,911 probably benign Het
Sap30bp A G 11: 115,933,488 probably benign Het
Scn1a A T 2: 66,287,731 S1433T probably damaging Het
Sde2 T C 1: 180,851,189 V6A probably benign Het
Sdk1 C A 5: 142,212,014 R2141S probably benign Het
Setd2 T C 9: 110,550,572 S1152P probably damaging Het
Slc26a2 C T 18: 61,201,854 V176I probably damaging Het
Snx7 A G 3: 117,846,632 I76T possibly damaging Het
Specc1l C A 10: 75,246,279 A520D probably benign Het
Spop A G 11: 95,471,310 T56A possibly damaging Het
Syne2 T A 12: 76,028,012 D4576E probably damaging Het
Tas2r134 A C 2: 51,627,589 M27L probably benign Het
Tecta A C 9: 42,366,786 I1142S probably benign Het
Timm44 T C 8: 4,266,611 D311G possibly damaging Het
Tmem123 C G 9: 7,791,070 T124R possibly damaging Het
Tmem184b A T 15: 79,362,759 L370Q probably benign Het
Trim25 T A 11: 88,999,503 N5K probably benign Het
Vmn2r93 A G 17: 18,304,641 Y187C probably damaging Het
Vpreb1 A G 16: 16,868,814 Y71H probably damaging Het
Vpreb2 T C 16: 17,980,577 S5P probably benign Het
Xpo7 A T 14: 70,669,448 C939S probably benign Het
Zfp78 C A 7: 6,378,765 S271R probably benign Het
Zic5 A T 14: 122,464,668 M217K probably benign Het
Other mutations in Guca1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Guca1a APN 17 47400384 missense probably damaging 0.99
IGL01684:Guca1a APN 17 47395143 missense probably null 0.83
IGL01969:Guca1a APN 17 47400343 missense probably damaging 0.99
IGL02441:Guca1a APN 17 47394653 unclassified probably benign
IGL03273:Guca1a APN 17 47395173 missense probably benign 0.00
R1216:Guca1a UTSW 17 47395712 unclassified probably benign
R1666:Guca1a UTSW 17 47400242 missense probably damaging 1.00
R4849:Guca1a UTSW 17 47394737 missense possibly damaging 0.82
R5433:Guca1a UTSW 17 47400370 missense probably damaging 0.99
Z1088:Guca1a UTSW 17 47400410 missense probably benign
Z1176:Guca1a UTSW 17 47400410 missense probably benign
Z1177:Guca1a UTSW 17 47400410 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGCATCCAGAGCAAAGGTG -3'
(R):5'- GCCCATACTGACTACTGACCTC -3'

Sequencing Primer
(F):5'- CATCCAGAGCAAAGGTGGGTAG -3'
(R):5'- GACTACTGACCTCGAGTTTGAGAC -3'
Posted On2019-05-13