Incidental Mutation 'R6996:Kdm2a'
ID544254
Institutional Source Beutler Lab
Gene Symbol Kdm2a
Ensembl Gene ENSMUSG00000054611
Gene Namelysine (K)-specific demethylase 2A
SynonymsGm4560, lalina, Fbl7, Jhdm1a, Cxxc8, Fbxl11, 5530401A10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R6996 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location4314419-4398285 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 4345641 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 321 (P321T)
Ref Sequence ENSEMBL: ENSMUSP00000139651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047898] [ENSMUST00000075856] [ENSMUST00000116571] [ENSMUST00000175959]
Predicted Effect probably benign
Transcript: ENSMUST00000047898
AA Change: P321T

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000047683
Gene: ENSMUSG00000054611
AA Change: P321T

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
low complexity region 127 138 N/A INTRINSIC
JmjC 148 316 1.52e-34 SMART
low complexity region 416 433 N/A INTRINSIC
PDB:2YU2|A 440 517 1e-35 PDB
Pfam:zf-CXXC 563 609 7.5e-16 PFAM
PHD 619 676 3.25e-4 SMART
low complexity region 848 875 N/A INTRINSIC
FBOX 892 932 1.58e-2 SMART
low complexity region 987 998 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075856
AA Change: P321T

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000076698
Gene: ENSMUSG00000054611
AA Change: P321T

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
low complexity region 127 138 N/A INTRINSIC
JmjC 148 316 1.52e-34 SMART
low complexity region 416 433 N/A INTRINSIC
PDB:2YU2|A 440 517 1e-35 PDB
Pfam:zf-CXXC 563 609 7.5e-16 PFAM
PHD 619 676 3.25e-4 SMART
low complexity region 848 875 N/A INTRINSIC
FBOX 892 932 1.58e-2 SMART
low complexity region 987 998 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000116571
AA Change: P321T

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000139651
Gene: ENSMUSG00000054611
AA Change: P321T

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
low complexity region 127 138 N/A INTRINSIC
JmjC 148 316 5.9e-37 SMART
low complexity region 416 433 N/A INTRINSIC
PDB:2YU2|A 440 493 4e-21 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000175959
SMART Domains Protein: ENSMUSP00000135689
Gene: ENSMUSG00000054611

DomainStartEndE-ValueType
PDB:2YU2|A 1 206 1e-140 PDB
Blast:JmjC 7 79 8e-23 BLAST
Blast:JmjC 125 206 3e-55 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbls class and, in addition to an F-box, contains at least six highly degenerated leucine-rich repeats. This family member plays a role in epigenetic silencing. It nucleates at CpG islands and specifically demethylates both mono- and di-methylated lysine-36 of histone H3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null allele show embryonic lethality, severe growth retardation, reduced neuron proliferation, increased neuron apoptosis, impaired neuron differentiation, small hearts, abnormal cardiac looping and, in some cases, incomplete embryonic turning and neural tube closure defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 G A 8: 24,806,501 S310L probably damaging Het
Adamts16 C T 13: 70,798,038 probably null Het
Arrb1 C A 7: 99,591,362 D194E probably benign Het
Atp1a3 T C 7: 24,997,626 D217G probably damaging Het
Bcar3 A G 3: 122,508,384 I123V possibly damaging Het
Bdp1 G A 13: 100,043,813 L1833F probably damaging Het
Cdc14a T C 3: 116,328,706 Y155C probably damaging Het
Cdo1 C A 18: 46,720,313 R126M possibly damaging Het
Cfap99 G T 5: 34,327,260 R627L probably damaging Het
Efr3a T A 15: 65,848,181 L369* probably null Het
Erich6 A C 3: 58,636,095 F185V probably damaging Het
Fam186a T C 15: 99,955,493 D122G unknown Het
Fank1 A G 7: 133,876,898 I230M possibly damaging Het
Flg2 A T 3: 93,202,670 E668D unknown Het
Flg2 A C 3: 93,202,949 R761S unknown Het
Gabrr1 T C 4: 33,158,157 L260P probably damaging Het
Gfm2 G A 13: 97,149,360 R119K probably damaging Het
Gm14226 A G 2: 155,024,437 T105A probably benign Het
Gm14496 A G 2: 181,996,204 N357S probably damaging Het
Gm5916 G A 9: 36,128,639 L18F probably benign Het
Gm884 A T 11: 103,618,757 L795* probably null Het
Golm1 A T 13: 59,642,244 N247K probably benign Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Greb1 C T 12: 16,723,354 A240T probably benign Het
Gtf3c6 T C 10: 40,249,778 M148V probably benign Het
Guca1a T C 17: 47,395,177 S126G probably benign Het
Hacl1 A T 14: 31,615,423 I393N possibly damaging Het
Hddc3 A G 7: 80,343,750 D68G possibly damaging Het
Hsfy2 T C 1: 56,636,410 T323A possibly damaging Het
Kcng2 T C 18: 80,323,143 probably benign Het
Krt31 A G 11: 100,047,732 V345A probably benign Het
Mettl1 T C 10: 127,045,018 S193P probably benign Het
Mme G A 3: 63,346,102 D456N possibly damaging Het
Mmrn1 A G 6: 60,977,383 T883A probably benign Het
Mphosph10 C G 7: 64,388,921 E293Q probably benign Het
Muc16 C A 9: 18,645,897 K3033N unknown Het
Myo16 C T 8: 10,569,496 T1349M probably damaging Het
Myo5c T C 9: 75,250,464 I233T probably benign Het
Olfr1356 C A 10: 78,847,517 V133L probably benign Het
Olfr1465 A T 19: 13,313,672 S204R probably benign Het
Olfr190 A G 16: 59,074,192 M296T probably benign Het
Olfr475-ps1 A G 2: 88,623,845 T181A unknown Het
Olfr622 T G 7: 103,639,858 N94T probably benign Het
Olfr655 A T 7: 104,596,811 F123L probably benign Het
Olfr791 T A 10: 129,526,863 V212E probably damaging Het
Oxct2b A G 4: 123,117,687 I467V probably benign Het
Parp1 A T 1: 180,587,371 N425Y possibly damaging Het
Pcdhgc3 T A 18: 37,806,603 V19D possibly damaging Het
Pfkl T A 10: 77,997,589 I260F probably damaging Het
Pkd1l1 C T 11: 8,849,046 G1789R probably damaging Het
Pla1a G A 16: 38,397,468 A386V probably benign Het
Pml A G 9: 58,234,886 L221P probably damaging Het
Rcn2 C T 9: 56,057,561 Q268* probably null Het
Reps1 T A 10: 18,093,855 D235E probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,911 probably benign Het
Sap30bp A G 11: 115,933,488 probably benign Het
Scn1a A T 2: 66,287,731 S1433T probably damaging Het
Sde2 T C 1: 180,851,189 V6A probably benign Het
Sdk1 C A 5: 142,212,014 R2141S probably benign Het
Setd2 T C 9: 110,550,572 S1152P probably damaging Het
Slc26a2 C T 18: 61,201,854 V176I probably damaging Het
Snx7 A G 3: 117,846,632 I76T possibly damaging Het
Specc1l C A 10: 75,246,279 A520D probably benign Het
Spop A G 11: 95,471,310 T56A possibly damaging Het
Syne2 T A 12: 76,028,012 D4576E probably damaging Het
Tas2r134 A C 2: 51,627,589 M27L probably benign Het
Tecta A C 9: 42,366,786 I1142S probably benign Het
Timm44 T C 8: 4,266,611 D311G possibly damaging Het
Tmem123 C G 9: 7,791,070 T124R possibly damaging Het
Tmem184b A T 15: 79,362,759 L370Q probably benign Het
Trim25 T A 11: 88,999,503 N5K probably benign Het
Vmn2r93 A G 17: 18,304,641 Y187C probably damaging Het
Vpreb1 A G 16: 16,868,814 Y71H probably damaging Het
Vpreb2 T C 16: 17,980,577 S5P probably benign Het
Xpo7 A T 14: 70,669,448 C939S probably benign Het
Zfp78 C A 7: 6,378,765 S271R probably benign Het
Zic5 A T 14: 122,464,668 M217K probably benign Het
Other mutations in Kdm2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Kdm2a APN 19 4356898 missense possibly damaging 0.94
IGL00679:Kdm2a APN 19 4326841 missense probably damaging 1.00
IGL01104:Kdm2a APN 19 4356738 splice site probably benign
IGL01161:Kdm2a APN 19 4319251 missense probably benign 0.04
IGL01433:Kdm2a APN 19 4342860 missense possibly damaging 0.83
IGL01456:Kdm2a APN 19 4351755 missense probably damaging 1.00
IGL01467:Kdm2a APN 19 4324407 missense probably damaging 0.99
IGL01517:Kdm2a APN 19 4362061 splice site probably benign
IGL01528:Kdm2a APN 19 4343055 missense probably benign 0.18
IGL02504:Kdm2a APN 19 4356771 missense possibly damaging 0.92
IGL02895:Kdm2a APN 19 4362902 missense probably damaging 1.00
IGL03109:Kdm2a APN 19 4329107 missense probably benign 0.04
IGL03171:Kdm2a APN 19 4356764 missense probably damaging 1.00
IGL03256:Kdm2a APN 19 4345510 unclassified probably benign
BB009:Kdm2a UTSW 19 4319156 missense probably damaging 0.98
BB019:Kdm2a UTSW 19 4319156 missense probably damaging 0.98
P0027:Kdm2a UTSW 19 4343245 splice site probably benign
PIT4382001:Kdm2a UTSW 19 4343173 missense probably benign
R0220:Kdm2a UTSW 19 4324919 missense possibly damaging 0.85
R0961:Kdm2a UTSW 19 4329191 missense probably benign 0.07
R1662:Kdm2a UTSW 19 4328212 missense probably damaging 1.00
R2023:Kdm2a UTSW 19 4322464 missense probably damaging 0.98
R2191:Kdm2a UTSW 19 4356931 splice site probably null
R2207:Kdm2a UTSW 19 4362870 missense probably damaging 1.00
R2351:Kdm2a UTSW 19 4329126 missense probably benign 0.02
R2406:Kdm2a UTSW 19 4322518 missense probably damaging 1.00
R2882:Kdm2a UTSW 19 4331184 critical splice donor site probably null
R3788:Kdm2a UTSW 19 4351805 missense probably damaging 0.99
R3792:Kdm2a UTSW 19 4324512 missense possibly damaging 0.91
R3950:Kdm2a UTSW 19 4343232 missense possibly damaging 0.89
R4235:Kdm2a UTSW 19 4322521 missense probably damaging 0.98
R4377:Kdm2a UTSW 19 4329054 missense probably benign 0.01
R4466:Kdm2a UTSW 19 4320300 missense probably damaging 0.99
R4766:Kdm2a UTSW 19 4324507 unclassified probably benign
R4824:Kdm2a UTSW 19 4362787 missense probably damaging 1.00
R4838:Kdm2a UTSW 19 4325026 missense probably benign 0.41
R5283:Kdm2a UTSW 19 4331269 missense probably benign 0.00
R6366:Kdm2a UTSW 19 4324932 missense probably benign 0.15
R6368:Kdm2a UTSW 19 4350317 missense probably damaging 1.00
R6522:Kdm2a UTSW 19 4324826 missense possibly damaging 0.49
R6716:Kdm2a UTSW 19 4329102 missense probably damaging 1.00
R6757:Kdm2a UTSW 19 4319243 missense probably damaging 0.98
R6912:Kdm2a UTSW 19 4322501 missense probably benign 0.06
R7090:Kdm2a UTSW 19 4319141 missense probably damaging 1.00
R7497:Kdm2a UTSW 19 4324376 missense probably damaging 1.00
R7542:Kdm2a UTSW 19 4333830 start gained probably benign
R7932:Kdm2a UTSW 19 4319156 missense probably damaging 0.98
R8199:Kdm2a UTSW 19 4389026 missense unknown
R8263:Kdm2a UTSW 19 4324364 missense possibly damaging 0.88
R8446:Kdm2a UTSW 19 4356888 nonsense probably null
RF046:Kdm2a UTSW 19 4324507 unclassified probably benign
X0028:Kdm2a UTSW 19 4320271 missense possibly damaging 0.77
X0028:Kdm2a UTSW 19 4348746 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTATATTGTCAGCTCTAGTGTGTC -3'
(R):5'- GGATGCCTTCATACTTACTCTAAAG -3'

Sequencing Primer
(F):5'- GTCAGCTCTAGTGTGTCTTAAAAG -3'
(R):5'- TGGGATTGCAGTTACAAGCTACC -3'
Posted On2019-05-13