Incidental Mutation 'R0608:Klhl11'
ID54426
Institutional Source Beutler Lab
Gene Symbol Klhl11
Ensembl Gene ENSMUSG00000048732
Gene Namekelch-like 11
Synonyms
MMRRC Submission 038797-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.708) question?
Stock #R0608 (G1)
Quality Score197
Status Not validated
Chromosome11
Chromosomal Location100462614-100472741 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100472242 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 163 (Y163H)
Ref Sequence ENSEMBL: ENSMUSP00000054963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007131] [ENSMUST00000056665] [ENSMUST00000107389] [ENSMUST00000165111]
Predicted Effect probably benign
Transcript: ENSMUST00000007131
SMART Domains Protein: ENSMUSP00000007131
Gene: ENSMUSG00000020917

DomainStartEndE-ValueType
Pfam:ATP-grasp_2 6 207 2.4e-8 PFAM
low complexity region 441 457 N/A INTRINSIC
low complexity region 465 475 N/A INTRINSIC
Pfam:CoA_binding 484 590 3.9e-14 PFAM
Pfam:Ligase_CoA 650 775 1.2e-16 PFAM
Pfam:Citrate_synt 868 1076 4.8e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000056665
AA Change: Y163H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054963
Gene: ENSMUSG00000048732
AA Change: Y163H

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
BTB 95 201 2.69e-21 SMART
BACK 206 308 9.54e-26 SMART
Kelch 361 408 4.1e0 SMART
Kelch 409 454 2.61e-1 SMART
Kelch 455 502 2.17e-1 SMART
Kelch 611 662 1.39e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107389
SMART Domains Protein: ENSMUSP00000103012
Gene: ENSMUSG00000020917

DomainStartEndE-ValueType
Pfam:Citrate_bind 244 421 1.7e-94 PFAM
low complexity region 441 457 N/A INTRINSIC
low complexity region 465 475 N/A INTRINSIC
Pfam:CoA_binding 494 600 6.6e-15 PFAM
Pfam:Ligase_CoA 660 785 2.1e-16 PFAM
Pfam:Citrate_synt 879 1085 2e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154151
Predicted Effect probably benign
Transcript: ENSMUST00000165111
SMART Domains Protein: ENSMUSP00000127632
Gene: ENSMUSG00000020917

DomainStartEndE-ValueType
Pfam:ATP-grasp_2 6 207 2.4e-8 PFAM
low complexity region 441 457 N/A INTRINSIC
low complexity region 465 475 N/A INTRINSIC
Pfam:CoA_binding 484 590 3.9e-14 PFAM
Pfam:Ligase_CoA 650 775 1.2e-16 PFAM
Pfam:Citrate_synt 868 1076 4.8e-22 PFAM
Meta Mutation Damage Score 0.8722 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730017C20Rik A G 18: 59,062,459 probably null Het
Akap11 A G 14: 78,510,753 V1398A probably benign Het
Ampd3 C A 7: 110,795,790 D315E probably damaging Het
Ampd3 T A 7: 110,795,791 F316I probably damaging Het
Arhgef40 A C 14: 51,996,974 E911D probably damaging Het
Atxn2l A G 7: 126,501,416 probably null Het
BC117090 T C 16: 36,323,024 probably null Het
Bckdhb T G 9: 83,953,736 F98V probably damaging Het
Calhm1 C T 19: 47,143,841 V112I probably benign Het
Ccdc28a G A 10: 18,224,951 R90C probably damaging Het
Cdc40 A T 10: 40,848,052 Y247N probably benign Het
Cds1 G A 5: 101,814,433 V305M probably damaging Het
Cep128 T G 12: 90,999,535 probably benign Het
Cep72 A T 13: 74,038,304 H249Q probably damaging Het
Cfap70 A T 14: 20,448,563 Y19N probably damaging Het
Col11a1 T C 3: 114,218,715 probably benign Het
Cysltr1 A G X: 106,578,655 V75A possibly damaging Het
Dnah17 G T 11: 118,090,749 Y1716* probably null Het
Dnm1 T C 2: 32,335,824 E383G possibly damaging Het
Dst C A 1: 34,290,356 probably null Het
Edil3 T C 13: 89,184,849 S375P probably damaging Het
Eme1 A G 11: 94,650,082 C277R probably damaging Het
Enam T C 5: 88,493,027 W183R possibly damaging Het
Fbxl6 C T 15: 76,536,753 V341M probably benign Het
Fgf14 A G 14: 124,676,603 S39P probably damaging Het
Fmo4 C T 1: 162,803,651 R249H possibly damaging Het
Gle1 T A 2: 29,940,228 D265E probably benign Het
Gml2 T C 15: 74,821,386 probably null Het
Golgb1 G T 16: 36,916,330 E1980* probably null Het
Hap1 A G 11: 100,349,305 L555P probably damaging Het
Heca T C 10: 17,915,291 D339G possibly damaging Het
Hepacam2 T C 6: 3,483,479 T101A possibly damaging Het
Ift88 T C 14: 57,496,221 V707A probably benign Het
Kdm3a C T 6: 71,620,046 G252D probably benign Het
Kntc1 A T 5: 123,786,074 N1008Y probably damaging Het
Lrp2 G T 2: 69,486,243 N2131K probably benign Het
Lrrc6 T A 15: 66,380,474 M448L probably benign Het
Magi3 C G 3: 104,017,557 G1092A probably damaging Het
Mef2a G T 7: 67,235,148 S406* probably null Het
Mrps26 G T 2: 130,563,858 R27L possibly damaging Het
Myof T C 19: 37,916,504 D1624G probably damaging Het
Naif1 T C 2: 32,454,896 M204T probably benign Het
Ndufb8 T C 19: 44,550,345 E179G possibly damaging Het
Neb A T 2: 52,326,757 D135E probably benign Het
Nlrp6 C T 7: 140,923,486 Q502* probably null Het
Nploc4 A G 11: 120,413,681 L238P probably damaging Het
Olfr463 G A 11: 87,893,196 H243Y probably damaging Het
Parp4 T A 14: 56,602,404 V523E probably damaging Het
Pdgfra T C 5: 75,163,777 Y98H probably damaging Het
Plcz1 C T 6: 139,990,733 R590H probably damaging Het
Pnliprp1 T A 19: 58,738,196 Y328* probably null Het
Pnpla8 C T 12: 44,283,463 P48L probably benign Het
Rab44 T A 17: 29,147,343 probably null Het
Ranbp2 T C 10: 58,493,898 I3031T probably damaging Het
Rnf219 T C 14: 104,479,527 Y470C probably damaging Het
Sbno1 T C 5: 124,384,541 D1072G probably damaging Het
Senp7 A G 16: 56,123,873 T187A possibly damaging Het
Serpinh1 A G 7: 99,349,394 C10R unknown Het
Sh2d4a A G 8: 68,346,694 Y405C possibly damaging Het
Slc26a7 T C 4: 14,621,317 D23G probably benign Het
Slc7a7 A G 14: 54,377,802 L246P probably damaging Het
Spire1 T C 18: 67,528,875 R163G probably damaging Het
Stxbp2 T A 8: 3,632,559 D49E probably damaging Het
Susd2 C T 10: 75,638,235 A509T probably benign Het
Sycp2 A G 2: 178,382,404 F396L probably damaging Het
Syne2 T C 12: 75,963,813 L2499P probably damaging Het
Syt10 C A 15: 89,826,941 A130S probably benign Het
Sytl4 A T X: 133,962,187 D16E probably benign Het
Tab2 C T 10: 7,920,119 V126I probably damaging Het
Tecpr1 T C 5: 144,211,499 T363A probably damaging Het
Terb2 A G 2: 122,186,335 D16G probably benign Het
Tm2d2 A G 8: 25,020,536 E137G probably benign Het
Trim30d T A 7: 104,472,485 H201L probably damaging Het
Tspan3 A G 9: 56,147,385 probably null Het
Ttn A T 2: 76,787,323 L16268Q probably damaging Het
Ttn A T 2: 76,796,185 probably null Het
Ubap2 T A 4: 41,218,319 T263S probably benign Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Zeb2 A T 2: 44,996,126 M973K possibly damaging Het
Zfp229 A G 17: 21,746,634 E615G probably damaging Het
Zfp655 T A 5: 145,244,057 S242T possibly damaging Het
Zfp788 T A 7: 41,648,281 F62I possibly damaging Het
Zmynd8 A G 2: 165,787,158 probably null Het
Other mutations in Klhl11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Klhl11 APN 11 100463205 missense possibly damaging 0.94
IGL02334:Klhl11 APN 11 100463836 missense probably damaging 1.00
IGL02886:Klhl11 APN 11 100472221 missense possibly damaging 0.92
R0372:Klhl11 UTSW 11 100463522 missense probably damaging 0.97
R0583:Klhl11 UTSW 11 100464324 missense possibly damaging 0.57
R0609:Klhl11 UTSW 11 100463714 missense probably damaging 1.00
R1417:Klhl11 UTSW 11 100472289 missense probably benign 0.00
R1629:Klhl11 UTSW 11 100464186 missense probably benign 0.00
R1643:Klhl11 UTSW 11 100463015 missense probably benign 0.09
R1985:Klhl11 UTSW 11 100463244 missense probably benign 0.00
R3844:Klhl11 UTSW 11 100472307 missense possibly damaging 0.84
R4746:Klhl11 UTSW 11 100464350 missense probably benign 0.00
R5053:Klhl11 UTSW 11 100472200 missense probably damaging 1.00
R5426:Klhl11 UTSW 11 100464116 missense probably damaging 1.00
R5731:Klhl11 UTSW 11 100463763 missense probably damaging 1.00
R5755:Klhl11 UTSW 11 100464351 missense probably benign 0.00
R6874:Klhl11 UTSW 11 100472205 missense probably benign 0.00
R7295:Klhl11 UTSW 11 100472242 missense probably damaging 1.00
R7426:Klhl11 UTSW 11 100464352 missense probably benign 0.17
R7554:Klhl11 UTSW 11 100463948 missense probably benign
Z1177:Klhl11 UTSW 11 100463966 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TTCTCTTGCCACTGCGAAGCTG -3'
(R):5'- TGTTCTGCGACATCACCCTGTG -3'

Sequencing Primer
(F):5'- TGTCATCATCACAGGAGTCG -3'
(R):5'- GACATCACCCTGTGCTTCG -3'
Posted On2013-07-11