Incidental Mutation 'R6997:Gpr158'
ID 544263
Institutional Source Beutler Lab
Gene Symbol Gpr158
Ensembl Gene ENSMUSG00000045967
Gene Name G protein-coupled receptor 158
Synonyms 5330427M13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6997 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 21367542-21830547 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 21648991 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 457 (T457I)
Ref Sequence ENSEMBL: ENSMUSP00000049708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055946]
AlphaFold Q8C419
Predicted Effect possibly damaging
Transcript: ENSMUST00000055946
AA Change: T457I

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000049708
Gene: ENSMUSG00000045967
AA Change: T457I

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 110 125 N/A INTRINSIC
SCOP:d1edmb_ 313 359 5e-4 SMART
Blast:EGF 318 365 2e-27 BLAST
Pfam:7tm_3 426 669 1.2e-35 PFAM
low complexity region 840 863 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam3 T C 8: 24,681,523 Y764C probably benign Het
Atxn1 C T 13: 45,567,619 V267M probably benign Het
Cadps T A 14: 12,505,793 H759L possibly damaging Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,099,982 probably benign Het
Caprin2 A G 6: 148,877,976 L111P probably damaging Het
Ccl8 A T 11: 82,116,039 D26V possibly damaging Het
Cdh19 T C 1: 110,954,866 probably benign Het
Cnga3 C A 1: 37,244,884 H89Q probably benign Het
Cnga4 A T 7: 105,406,983 Q264L probably damaging Het
Coil A G 11: 88,981,847 T345A probably benign Het
Cyp11b2 A G 15: 74,851,432 L461P probably damaging Het
Dock2 T C 11: 34,464,922 E151G probably damaging Het
Dsc1 C T 18: 20,086,644 probably null Het
Dync2h1 A T 9: 7,168,743 C357S probably null Het
Ebf3 A C 7: 137,225,265 I306R probably damaging Het
Eprs A G 1: 185,396,163 H580R possibly damaging Het
Ermap A T 4: 119,178,613 F393I probably damaging Het
Flii T C 11: 60,722,325 T217A probably benign Het
Fras1 C T 5: 96,614,873 Q745* probably null Het
Gja8 A G 3: 96,919,341 V335A probably benign Het
Gm21560 A T 14: 6,218,333 N48K probably damaging Het
Kcnv1 A T 15: 45,114,601 S14T unknown Het
Lamb2 T C 9: 108,481,297 Y178H probably damaging Het
Lamc2 G A 1: 153,136,762 T722M probably benign Het
Map1b T C 13: 99,430,634 T1860A unknown Het
Map2k7 T C 8: 4,244,035 Y194H possibly damaging Het
Map4 T A 9: 110,052,914 M282K probably benign Het
Mkl1 G T 15: 81,018,448 S220* probably null Het
Mmp10 A G 9: 7,503,530 I134V probably benign Het
Msh5 A T 17: 35,030,002 L685Q probably damaging Het
Myh1 T A 11: 67,220,637 I1634N possibly damaging Het
Myh13 C T 11: 67,327,154 R18* probably null Het
Myo3b A T 2: 70,126,985 I185L probably damaging Het
Ninl G T 2: 150,966,225 H294Q probably benign Het
Olfr1252 G A 2: 89,721,925 A62V possibly damaging Het
Olfr64 A T 7: 103,893,031 S235T probably benign Het
Olfr907 T C 9: 38,499,311 I214T possibly damaging Het
Orm3 T A 4: 63,356,943 L97Q probably damaging Het
Osbpl1a T C 18: 12,756,224 N432S probably benign Het
Pikfyve T A 1: 65,246,663 D1020E probably damaging Het
Pxk T A 14: 8,122,371 D60E probably benign Het
Rack1 T A 11: 48,803,925 V198E probably damaging Het
Ripk1 C T 13: 34,017,117 A271V probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Ryr2 G T 13: 11,654,380 H3513N possibly damaging Het
Scn7a A T 2: 66,703,803 D509E probably damaging Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Sfxn5 A G 6: 85,256,432 V181A probably benign Het
Slc5a4b C T 10: 76,089,978 A198T probably damaging Het
Sp2 C T 11: 96,957,726 R357H possibly damaging Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Tnfrsf11b G A 15: 54,252,374 L276F probably damaging Het
Usp37 A G 1: 74,453,959 V723A probably benign Het
Usp45 G T 4: 21,781,844 R36I probably damaging Het
Vcan T C 13: 89,690,618 D2269G probably damaging Het
Vmn2r18 T A 5: 151,561,873 M719L possibly damaging Het
Vmn2r52 C T 7: 10,169,071 G477R probably benign Het
Vmn2r60 C A 7: 42,142,292 N546K probably benign Het
Wnt8b G A 19: 44,511,841 C289Y probably damaging Het
Zdbf2 T G 1: 63,290,766 M10R probably benign Het
Zfp945 T A 17: 22,852,569 K140* probably null Het
Other mutations in Gpr158
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Gpr158 APN 2 21368683 missense probably damaging 1.00
IGL00469:Gpr158 APN 2 21746795 splice site probably benign
IGL00706:Gpr158 APN 2 21746773 missense probably damaging 1.00
IGL00780:Gpr158 APN 2 21826818 nonsense probably null
IGL00885:Gpr158 APN 2 21649021 missense probably damaging 1.00
IGL01339:Gpr158 APN 2 21369031 missense possibly damaging 0.73
IGL01368:Gpr158 APN 2 21827098 missense probably damaging 1.00
IGL02141:Gpr158 APN 2 21783290 missense probably damaging 0.99
IGL02455:Gpr158 APN 2 21368700 missense probably benign 0.00
IGL02554:Gpr158 APN 2 21826596 missense probably benign
IGL02681:Gpr158 APN 2 21815630 missense probably damaging 1.00
IGL02752:Gpr158 APN 2 21826827 missense possibly damaging 0.95
IGL02756:Gpr158 APN 2 21827079 missense possibly damaging 0.47
IGL03181:Gpr158 APN 2 21783161 missense probably benign 0.02
IGL03258:Gpr158 APN 2 21825274 missense probably damaging 1.00
IGL03386:Gpr158 APN 2 21826246 missense probably damaging 1.00
PIT4810001:Gpr158 UTSW 2 21826871 missense probably benign 0.01
R0071:Gpr158 UTSW 2 21810668 missense probably benign 0.08
R0081:Gpr158 UTSW 2 21826717 missense probably damaging 1.00
R0528:Gpr158 UTSW 2 21825208 missense probably damaging 1.00
R0560:Gpr158 UTSW 2 21825274 missense probably damaging 1.00
R0603:Gpr158 UTSW 2 21815669 missense possibly damaging 0.67
R1560:Gpr158 UTSW 2 21826314 missense probably damaging 1.00
R1561:Gpr158 UTSW 2 21815694 splice site probably null
R1609:Gpr158 UTSW 2 21783293 missense possibly damaging 0.61
R1741:Gpr158 UTSW 2 21827548 missense probably benign 0.00
R1827:Gpr158 UTSW 2 21827318 missense probably benign
R1854:Gpr158 UTSW 2 21369124 missense probably damaging 1.00
R1871:Gpr158 UTSW 2 21815615 missense probably damaging 1.00
R2151:Gpr158 UTSW 2 21827514 missense possibly damaging 0.82
R2273:Gpr158 UTSW 2 21826863 missense probably benign
R2275:Gpr158 UTSW 2 21826863 missense probably benign
R3004:Gpr158 UTSW 2 21826999 missense probably damaging 0.99
R3151:Gpr158 UTSW 2 21576960 missense possibly damaging 0.68
R3943:Gpr158 UTSW 2 21368559 missense possibly damaging 0.65
R4238:Gpr158 UTSW 2 21368551 missense probably damaging 1.00
R4379:Gpr158 UTSW 2 21825214 missense probably damaging 1.00
R4381:Gpr158 UTSW 2 21827592 missense probably damaging 1.00
R4464:Gpr158 UTSW 2 21826999 missense probably damaging 0.99
R4467:Gpr158 UTSW 2 21826999 missense probably damaging 0.99
R4496:Gpr158 UTSW 2 21826999 missense probably damaging 0.99
R4506:Gpr158 UTSW 2 21826999 missense probably damaging 0.99
R4530:Gpr158 UTSW 2 21369000 missense probably benign 0.03
R4646:Gpr158 UTSW 2 21827053 missense probably benign
R4798:Gpr158 UTSW 2 21783182 missense probably damaging 1.00
R4882:Gpr158 UTSW 2 21825248 missense probably damaging 0.98
R4943:Gpr158 UTSW 2 21827157 missense probably damaging 1.00
R5334:Gpr158 UTSW 2 21827505 missense probably benign 0.01
R5560:Gpr158 UTSW 2 21826290 missense possibly damaging 0.67
R5600:Gpr158 UTSW 2 21827235 missense probably benign
R5637:Gpr158 UTSW 2 21783272 missense probably benign 0.00
R5701:Gpr158 UTSW 2 21746709 missense probably damaging 1.00
R5744:Gpr158 UTSW 2 21368520 missense probably damaging 1.00
R5911:Gpr158 UTSW 2 21369121 missense possibly damaging 0.95
R5991:Gpr158 UTSW 2 21368508 missense probably damaging 0.99
R6200:Gpr158 UTSW 2 21399416 missense probably damaging 0.97
R6306:Gpr158 UTSW 2 21815611 missense possibly damaging 0.84
R6324:Gpr158 UTSW 2 21810554 missense probably damaging 1.00
R6384:Gpr158 UTSW 2 21826288 missense probably damaging 1.00
R6698:Gpr158 UTSW 2 21827110 missense probably damaging 1.00
R7086:Gpr158 UTSW 2 21826575 missense probably benign 0.01
R7175:Gpr158 UTSW 2 21368302 missense probably benign 0.13
R7197:Gpr158 UTSW 2 21810601 missense probably damaging 0.99
R7293:Gpr158 UTSW 2 21576939 missense possibly damaging 0.47
R7427:Gpr158 UTSW 2 21827318 missense probably benign
R7515:Gpr158 UTSW 2 21368281 missense probably damaging 1.00
R7730:Gpr158 UTSW 2 21826347 missense probably damaging 1.00
R8122:Gpr158 UTSW 2 21826863 missense probably benign
R8311:Gpr158 UTSW 2 21368890 missense probably benign 0.00
R8754:Gpr158 UTSW 2 21576882 missense probably benign 0.00
R8782:Gpr158 UTSW 2 21399338 missense probably damaging 1.00
R8792:Gpr158 UTSW 2 21553326 missense probably damaging 1.00
R8842:Gpr158 UTSW 2 21576940 missense possibly damaging 0.88
R9009:Gpr158 UTSW 2 21576949 missense probably damaging 1.00
R9102:Gpr158 UTSW 2 21825267 missense probably damaging 1.00
R9150:Gpr158 UTSW 2 21826440 missense probably benign 0.17
R9254:Gpr158 UTSW 2 21368231 start gained probably benign
R9317:Gpr158 UTSW 2 21827226 missense probably benign
R9379:Gpr158 UTSW 2 21368231 start gained probably benign
R9428:Gpr158 UTSW 2 21783161 missense probably benign
R9497:Gpr158 UTSW 2 21827014 missense probably benign 0.00
R9667:Gpr158 UTSW 2 21825243 missense probably damaging 0.99
R9681:Gpr158 UTSW 2 21826504 missense probably damaging 0.99
X0062:Gpr158 UTSW 2 21826369 missense probably damaging 1.00
Z1176:Gpr158 UTSW 2 21810690 critical splice donor site probably null
Z1177:Gpr158 UTSW 2 21827272 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- CCACCTGAACACTAGCTAGATTTC -3'
(R):5'- AACATGTGCACTAAATAGGACCTTC -3'

Sequencing Primer
(F):5'- TTGTCCGGAAGAATGCTG -3'
(R):5'- GTGCACTAAATAGGACCTTCATATGC -3'
Posted On 2019-05-13