Incidental Mutation 'R0608:Pnpla8'
ID54429
Institutional Source Beutler Lab
Gene Symbol Pnpla8
Ensembl Gene ENSMUSG00000036257
Gene Namepatatin-like phospholipase domain containing 8
Synonyms1200006O19Rik, iPLA2 gamma
MMRRC Submission 038797-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.294) question?
Stock #R0608 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location44221370-44322532 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 44283463 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 48 (P48L)
Ref Sequence ENSEMBL: ENSMUSP00000151660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043082] [ENSMUST00000122902] [ENSMUST00000125757] [ENSMUST00000143771] [ENSMUST00000218954]
Predicted Effect probably benign
Transcript: ENSMUST00000043082
AA Change: P266L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000043286
Gene: ENSMUSG00000036257
AA Change: P266L

DomainStartEndE-ValueType
SCOP:d1gw5a_ 332 430 2e-3 SMART
Pfam:Patatin 439 634 1.4e-26 PFAM
low complexity region 664 675 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122902
AA Change: P48L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120877
Gene: ENSMUSG00000036257
AA Change: P48L

DomainStartEndE-ValueType
SCOP:d1gw5a_ 114 212 2e-3 SMART
Pfam:Patatin 221 416 3e-27 PFAM
low complexity region 446 457 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125757
Predicted Effect probably benign
Transcript: ENSMUST00000143771
AA Change: P266L

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000122560
Gene: ENSMUSG00000036257
AA Change: P266L

DomainStartEndE-ValueType
SCOP:d1gw5a_ 332 430 3e-3 SMART
Pfam:Patatin 439 658 7.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218954
AA Change: P48L

PolyPhen 2 Score 0.361 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the patatin-like phospholipase domain containing protein family. Members of this family are phospholipases which catalyze the cleavage of fatty acids from membrane phospholipids. The product of this gene is a calcium-independent phospholipase. Mutations in this gene have been associated with mitochondrial myopathy with lactic acidosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit some female-specific embryonic lethality, reduced body weight and temperature, cold intolerance, decreased exercise tolerance and decreased mitochondria function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730017C20Rik A G 18: 59,062,459 probably null Het
Akap11 A G 14: 78,510,753 V1398A probably benign Het
Ampd3 C A 7: 110,795,790 D315E probably damaging Het
Ampd3 T A 7: 110,795,791 F316I probably damaging Het
Arhgef40 A C 14: 51,996,974 E911D probably damaging Het
Atxn2l A G 7: 126,501,416 probably null Het
BC117090 T C 16: 36,323,024 probably null Het
Bckdhb T G 9: 83,953,736 F98V probably damaging Het
Calhm1 C T 19: 47,143,841 V112I probably benign Het
Ccdc28a G A 10: 18,224,951 R90C probably damaging Het
Cdc40 A T 10: 40,848,052 Y247N probably benign Het
Cds1 G A 5: 101,814,433 V305M probably damaging Het
Cep128 T G 12: 90,999,535 probably benign Het
Cep72 A T 13: 74,038,304 H249Q probably damaging Het
Cfap70 A T 14: 20,448,563 Y19N probably damaging Het
Col11a1 T C 3: 114,218,715 probably benign Het
Cysltr1 A G X: 106,578,655 V75A possibly damaging Het
Dnah17 G T 11: 118,090,749 Y1716* probably null Het
Dnm1 T C 2: 32,335,824 E383G possibly damaging Het
Dst C A 1: 34,290,356 probably null Het
Edil3 T C 13: 89,184,849 S375P probably damaging Het
Eme1 A G 11: 94,650,082 C277R probably damaging Het
Enam T C 5: 88,493,027 W183R possibly damaging Het
Fbxl6 C T 15: 76,536,753 V341M probably benign Het
Fgf14 A G 14: 124,676,603 S39P probably damaging Het
Fmo4 C T 1: 162,803,651 R249H possibly damaging Het
Gle1 T A 2: 29,940,228 D265E probably benign Het
Gml2 T C 15: 74,821,386 probably null Het
Golgb1 G T 16: 36,916,330 E1980* probably null Het
Hap1 A G 11: 100,349,305 L555P probably damaging Het
Heca T C 10: 17,915,291 D339G possibly damaging Het
Hepacam2 T C 6: 3,483,479 T101A possibly damaging Het
Ift88 T C 14: 57,496,221 V707A probably benign Het
Kdm3a C T 6: 71,620,046 G252D probably benign Het
Klhl11 A G 11: 100,472,242 Y163H probably damaging Het
Kntc1 A T 5: 123,786,074 N1008Y probably damaging Het
Lrp2 G T 2: 69,486,243 N2131K probably benign Het
Lrrc6 T A 15: 66,380,474 M448L probably benign Het
Magi3 C G 3: 104,017,557 G1092A probably damaging Het
Mef2a G T 7: 67,235,148 S406* probably null Het
Mrps26 G T 2: 130,563,858 R27L possibly damaging Het
Myof T C 19: 37,916,504 D1624G probably damaging Het
Naif1 T C 2: 32,454,896 M204T probably benign Het
Ndufb8 T C 19: 44,550,345 E179G possibly damaging Het
Neb A T 2: 52,326,757 D135E probably benign Het
Nlrp6 C T 7: 140,923,486 Q502* probably null Het
Nploc4 A G 11: 120,413,681 L238P probably damaging Het
Olfr463 G A 11: 87,893,196 H243Y probably damaging Het
Parp4 T A 14: 56,602,404 V523E probably damaging Het
Pdgfra T C 5: 75,163,777 Y98H probably damaging Het
Plcz1 C T 6: 139,990,733 R590H probably damaging Het
Pnliprp1 T A 19: 58,738,196 Y328* probably null Het
Rab44 T A 17: 29,147,343 probably null Het
Ranbp2 T C 10: 58,493,898 I3031T probably damaging Het
Rnf219 T C 14: 104,479,527 Y470C probably damaging Het
Sbno1 T C 5: 124,384,541 D1072G probably damaging Het
Senp7 A G 16: 56,123,873 T187A possibly damaging Het
Serpinh1 A G 7: 99,349,394 C10R unknown Het
Sh2d4a A G 8: 68,346,694 Y405C possibly damaging Het
Slc26a7 T C 4: 14,621,317 D23G probably benign Het
Slc7a7 A G 14: 54,377,802 L246P probably damaging Het
Spire1 T C 18: 67,528,875 R163G probably damaging Het
Stxbp2 T A 8: 3,632,559 D49E probably damaging Het
Susd2 C T 10: 75,638,235 A509T probably benign Het
Sycp2 A G 2: 178,382,404 F396L probably damaging Het
Syne2 T C 12: 75,963,813 L2499P probably damaging Het
Syt10 C A 15: 89,826,941 A130S probably benign Het
Sytl4 A T X: 133,962,187 D16E probably benign Het
Tab2 C T 10: 7,920,119 V126I probably damaging Het
Tecpr1 T C 5: 144,211,499 T363A probably damaging Het
Terb2 A G 2: 122,186,335 D16G probably benign Het
Tm2d2 A G 8: 25,020,536 E137G probably benign Het
Trim30d T A 7: 104,472,485 H201L probably damaging Het
Tspan3 A G 9: 56,147,385 probably null Het
Ttn A T 2: 76,787,323 L16268Q probably damaging Het
Ttn A T 2: 76,796,185 probably null Het
Ubap2 T A 4: 41,218,319 T263S probably benign Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Zeb2 A T 2: 44,996,126 M973K possibly damaging Het
Zfp229 A G 17: 21,746,634 E615G probably damaging Het
Zfp655 T A 5: 145,244,057 S242T possibly damaging Het
Zfp788 T A 7: 41,648,281 F62I possibly damaging Het
Zmynd8 A G 2: 165,787,158 probably null Het
Other mutations in Pnpla8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Pnpla8 APN 12 44283069 missense probably benign 0.00
IGL01477:Pnpla8 APN 12 44283658 missense probably damaging 0.98
IGL01963:Pnpla8 APN 12 44296033 missense possibly damaging 0.88
IGL02877:Pnpla8 APN 12 44283465 missense probably benign 0.13
IGL03085:Pnpla8 APN 12 44311522 missense probably benign 0.01
IGL03335:Pnpla8 APN 12 44283164 missense probably benign 0.03
IGL03396:Pnpla8 APN 12 44283526 missense probably benign 0.01
Bantamweight UTSW 12 44304947 missense possibly damaging 0.65
featherweight UTSW 12 44295970 nonsense probably null
freerange UTSW 12 44283247 missense possibly damaging 0.94
R0063:Pnpla8 UTSW 12 44282832 missense probably damaging 1.00
R0063:Pnpla8 UTSW 12 44282832 missense probably damaging 1.00
R0172:Pnpla8 UTSW 12 44311328 missense probably damaging 1.00
R0524:Pnpla8 UTSW 12 44283618 nonsense probably null
R0811:Pnpla8 UTSW 12 44283405 missense probably benign 0.03
R0812:Pnpla8 UTSW 12 44283405 missense probably benign 0.03
R1120:Pnpla8 UTSW 12 44304947 missense possibly damaging 0.65
R2127:Pnpla8 UTSW 12 44308057 missense probably benign 0.37
R2392:Pnpla8 UTSW 12 44311504 missense probably damaging 1.00
R4411:Pnpla8 UTSW 12 44283442 missense probably benign 0.00
R4714:Pnpla8 UTSW 12 44295913 missense probably damaging 1.00
R5446:Pnpla8 UTSW 12 44290585 missense possibly damaging 0.94
R5585:Pnpla8 UTSW 12 44283064 missense probably benign 0.06
R5752:Pnpla8 UTSW 12 44282887 missense probably benign 0.04
R5914:Pnpla8 UTSW 12 44295970 nonsense probably null
R6125:Pnpla8 UTSW 12 44307989 missense possibly damaging 0.65
R6135:Pnpla8 UTSW 12 44282887 missense probably benign 0.04
R6224:Pnpla8 UTSW 12 44283028 missense possibly damaging 0.82
R6905:Pnpla8 UTSW 12 44283553 missense probably damaging 1.00
R6933:Pnpla8 UTSW 12 44283427 missense probably benign 0.00
R6983:Pnpla8 UTSW 12 44283247 missense possibly damaging 0.94
R7334:Pnpla8 UTSW 12 44311503 missense probably damaging 1.00
R7529:Pnpla8 UTSW 12 44283180 missense probably benign 0.00
R7996:Pnpla8 UTSW 12 44282983 nonsense probably null
R8263:Pnpla8 UTSW 12 44296063 missense probably damaging 1.00
R8401:Pnpla8 UTSW 12 44288308 missense probably damaging 1.00
Z1176:Pnpla8 UTSW 12 44295990 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TTAGCACTTCTGCTCCCAAGGGAC -3'
(R):5'- GCCTTTTCTTGCTGAAGTAGCACAC -3'

Sequencing Primer
(F):5'- TTAAGCAAGCCGTCGAGTCTC -3'
(R):5'- TGAAGTAGCACACGCTTTTTC -3'
Posted On2013-07-11