Incidental Mutation 'R6997:Osbpl1a'
ID 544315
Institutional Source Beutler Lab
Gene Symbol Osbpl1a
Ensembl Gene ENSMUSG00000044252
Gene Name oxysterol binding protein-like 1A
Synonyms LOC328902, G430090F17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock # R6997 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 12755314-12941841 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 12756224 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 432 (N432S)
Ref Sequence ENSEMBL: ENSMUSP00000112895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074352] [ENSMUST00000080415] [ENSMUST00000115857] [ENSMUST00000117361] [ENSMUST00000118313] [ENSMUST00000119043] [ENSMUST00000119108] [ENSMUST00000119512] [ENSMUST00000121018] [ENSMUST00000121774] [ENSMUST00000121808] [ENSMUST00000121888] [ENSMUST00000150758] [ENSMUST00000186263] [ENSMUST00000191078]
AlphaFold Q91XL9
Predicted Effect probably benign
Transcript: ENSMUST00000074352
AA Change: N945S

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000073957
Gene: ENSMUSG00000044252
AA Change: N945S

DomainStartEndE-ValueType
ANK 47 76 2.05e-6 SMART
ANK 80 109 1.29e-3 SMART
low complexity region 141 153 N/A INTRINSIC
ANK 175 204 1.31e-4 SMART
PH 236 336 6.02e-8 SMART
low complexity region 345 354 N/A INTRINSIC
coiled coil region 430 463 N/A INTRINSIC
Pfam:Oxysterol_BP 548 940 6.7e-149 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080415
SMART Domains Protein: ENSMUSP00000079277
Gene: ENSMUSG00000024430

DomainStartEndE-ValueType
Pfam:RIIa 12 46 2.3e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115857
SMART Domains Protein: ENSMUSP00000111523
Gene: ENSMUSG00000024430

DomainStartEndE-ValueType
Pfam:RIIa 12 46 2.2e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117361
AA Change: N432S

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000112681
Gene: ENSMUSG00000044252
AA Change: N432S

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118313
AA Change: N432S

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000113735
Gene: ENSMUSG00000044252
AA Change: N432S

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119043
AA Change: N432S

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000113357
Gene: ENSMUSG00000044252
AA Change: N432S

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119108
SMART Domains Protein: ENSMUSP00000113760
Gene: ENSMUSG00000024430

DomainStartEndE-ValueType
Pfam:RIIa 12 46 8.5e-13 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119512
AA Change: N553S

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000113914
Gene: ENSMUSG00000044252
AA Change: N553S

DomainStartEndE-ValueType
coiled coil region 38 71 N/A INTRINSIC
Pfam:Oxysterol_BP 156 549 1.2e-149 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121018
SMART Domains Protein: ENSMUSP00000113131
Gene: ENSMUSG00000024430

DomainStartEndE-ValueType
Pfam:RIIa 12 46 6.7e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
low complexity region 213 223 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121774
AA Change: N405S

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000113268
Gene: ENSMUSG00000044252
AA Change: N405S

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 8 401 4e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121808
AA Change: N432S

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000113841
Gene: ENSMUSG00000044252
AA Change: N432S

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121888
AA Change: N432S

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000112895
Gene: ENSMUSG00000044252
AA Change: N432S

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150758
SMART Domains Protein: ENSMUSP00000118330
Gene: ENSMUSG00000024430

DomainStartEndE-ValueType
Pfam:RIIa 12 46 2.3e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186263
SMART Domains Protein: ENSMUSP00000140870
Gene: ENSMUSG00000024430

DomainStartEndE-ValueType
Pfam:RIIa 12 46 2.3e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191078
SMART Domains Protein: ENSMUSP00000140894
Gene: ENSMUSG00000024430

DomainStartEndE-ValueType
Pfam:RIIa 12 46 2.3e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Meta Mutation Damage Score 0.0611 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors. Most members contain an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain, although some members contain only the sterol-binding domain. Transcript variants derived from alternative promoter usage and/or alternative splicing exist; they encode different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam3 T C 8: 24,681,523 Y764C probably benign Het
Atxn1 C T 13: 45,567,619 V267M probably benign Het
Cadps T A 14: 12,505,793 H759L possibly damaging Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,099,982 probably benign Het
Caprin2 A G 6: 148,877,976 L111P probably damaging Het
Ccl8 A T 11: 82,116,039 D26V possibly damaging Het
Cdh19 T C 1: 110,954,866 probably benign Het
Cnga3 C A 1: 37,244,884 H89Q probably benign Het
Cnga4 A T 7: 105,406,983 Q264L probably damaging Het
Coil A G 11: 88,981,847 T345A probably benign Het
Cyp11b2 A G 15: 74,851,432 L461P probably damaging Het
Dock2 T C 11: 34,464,922 E151G probably damaging Het
Dsc1 C T 18: 20,086,644 probably null Het
Dync2h1 A T 9: 7,168,743 C357S probably null Het
Ebf3 A C 7: 137,225,265 I306R probably damaging Het
Eprs A G 1: 185,396,163 H580R possibly damaging Het
Ermap A T 4: 119,178,613 F393I probably damaging Het
Flii T C 11: 60,722,325 T217A probably benign Het
Fras1 C T 5: 96,614,873 Q745* probably null Het
Gja8 A G 3: 96,919,341 V335A probably benign Het
Gm21560 A T 14: 6,218,333 N48K probably damaging Het
Gpr158 C T 2: 21,648,991 T457I possibly damaging Het
Kcnv1 A T 15: 45,114,601 S14T unknown Het
Lamb2 T C 9: 108,481,297 Y178H probably damaging Het
Lamc2 G A 1: 153,136,762 T722M probably benign Het
Map1b T C 13: 99,430,634 T1860A unknown Het
Map2k7 T C 8: 4,244,035 Y194H possibly damaging Het
Map4 T A 9: 110,052,914 M282K probably benign Het
Mkl1 G T 15: 81,018,448 S220* probably null Het
Mmp10 A G 9: 7,503,530 I134V probably benign Het
Msh5 A T 17: 35,030,002 L685Q probably damaging Het
Myh1 T A 11: 67,220,637 I1634N possibly damaging Het
Myh13 C T 11: 67,327,154 R18* probably null Het
Myo3b A T 2: 70,126,985 I185L probably damaging Het
Ninl G T 2: 150,966,225 H294Q probably benign Het
Olfr1252 G A 2: 89,721,925 A62V possibly damaging Het
Olfr64 A T 7: 103,893,031 S235T probably benign Het
Olfr907 T C 9: 38,499,311 I214T possibly damaging Het
Orm3 T A 4: 63,356,943 L97Q probably damaging Het
Pikfyve T A 1: 65,246,663 D1020E probably damaging Het
Pxk T A 14: 8,122,371 D60E probably benign Het
Rack1 T A 11: 48,803,925 V198E probably damaging Het
Ripk1 C T 13: 34,017,117 A271V probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Ryr2 G T 13: 11,654,380 H3513N possibly damaging Het
Scn7a A T 2: 66,703,803 D509E probably damaging Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Sfxn5 A G 6: 85,256,432 V181A probably benign Het
Slc5a4b C T 10: 76,089,978 A198T probably damaging Het
Sp2 C T 11: 96,957,726 R357H possibly damaging Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Tnfrsf11b G A 15: 54,252,374 L276F probably damaging Het
Usp37 A G 1: 74,453,959 V723A probably benign Het
Usp45 G T 4: 21,781,844 R36I probably damaging Het
Vcan T C 13: 89,690,618 D2269G probably damaging Het
Vmn2r18 T A 5: 151,561,873 M719L possibly damaging Het
Vmn2r52 C T 7: 10,169,071 G477R probably benign Het
Vmn2r60 C A 7: 42,142,292 N546K probably benign Het
Wnt8b G A 19: 44,511,841 C289Y probably damaging Het
Zdbf2 T G 1: 63,290,766 M10R probably benign Het
Zfp945 T A 17: 22,852,569 K140* probably null Het
Other mutations in Osbpl1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Osbpl1a APN 18 12757626 missense possibly damaging 0.51
IGL01062:Osbpl1a APN 18 12905075 missense probably benign
IGL01450:Osbpl1a APN 18 12871095 missense possibly damaging 0.88
IGL01531:Osbpl1a APN 18 12933581 missense probably damaging 1.00
IGL01548:Osbpl1a APN 18 12763575 missense probably damaging 1.00
IGL01606:Osbpl1a APN 18 12756214 missense possibly damaging 0.79
IGL01672:Osbpl1a APN 18 12766824 missense probably damaging 1.00
IGL02372:Osbpl1a APN 18 12841313 nonsense probably null
IGL02451:Osbpl1a APN 18 12914493 splice site probably benign
IGL02490:Osbpl1a APN 18 12882284 unclassified probably benign
IGL02884:Osbpl1a APN 18 12819578 nonsense probably null
R0084:Osbpl1a UTSW 18 12757612 missense probably benign 0.07
R0266:Osbpl1a UTSW 18 12871163 splice site probably null
R0565:Osbpl1a UTSW 18 12759444 missense probably damaging 1.00
R0605:Osbpl1a UTSW 18 12882279 critical splice acceptor site probably null
R0899:Osbpl1a UTSW 18 12757690 missense possibly damaging 0.70
R1330:Osbpl1a UTSW 18 12882194 critical splice donor site probably null
R1464:Osbpl1a UTSW 18 12914558 missense probably benign
R1464:Osbpl1a UTSW 18 12914558 missense probably benign
R1475:Osbpl1a UTSW 18 12757680 missense probably damaging 1.00
R1495:Osbpl1a UTSW 18 12758839 missense probably benign 0.08
R1734:Osbpl1a UTSW 18 12788316 splice site probably null
R1930:Osbpl1a UTSW 18 12905194 missense probably benign 0.04
R1931:Osbpl1a UTSW 18 12905194 missense probably benign 0.04
R2109:Osbpl1a UTSW 18 12759400 missense probably damaging 1.00
R2144:Osbpl1a UTSW 18 12871173 missense probably benign 0.06
R2504:Osbpl1a UTSW 18 12905031 missense probably benign 0.30
R2762:Osbpl1a UTSW 18 12766899 missense possibly damaging 0.83
R2907:Osbpl1a UTSW 18 12871072 unclassified probably benign
R4306:Osbpl1a UTSW 18 12819595 missense probably benign
R4835:Osbpl1a UTSW 18 12768536 critical splice donor site probably null
R5097:Osbpl1a UTSW 18 12763537 missense probably damaging 1.00
R5173:Osbpl1a UTSW 18 12762640 missense probably benign 0.12
R5224:Osbpl1a UTSW 18 12933696 missense probably benign 0.01
R5245:Osbpl1a UTSW 18 12758853 missense probably damaging 1.00
R5579:Osbpl1a UTSW 18 12841192 missense probably damaging 1.00
R5579:Osbpl1a UTSW 18 12892262 missense probably benign 0.22
R5833:Osbpl1a UTSW 18 12788362 missense probably damaging 1.00
R5986:Osbpl1a UTSW 18 12905081 missense probably damaging 1.00
R6267:Osbpl1a UTSW 18 12819503 critical splice donor site probably null
R6296:Osbpl1a UTSW 18 12819503 critical splice donor site probably null
R6477:Osbpl1a UTSW 18 12756261 missense probably benign 0.03
R7105:Osbpl1a UTSW 18 12766963 missense probably benign 0.17
R7107:Osbpl1a UTSW 18 12841253 nonsense probably null
R7154:Osbpl1a UTSW 18 12768592 missense probably benign 0.00
R7459:Osbpl1a UTSW 18 12933585 missense probably damaging 1.00
R7757:Osbpl1a UTSW 18 12933600 missense probably benign 0.44
R7797:Osbpl1a UTSW 18 12882264 missense probably damaging 0.99
R8029:Osbpl1a UTSW 18 12914521 missense probably benign 0.01
R8084:Osbpl1a UTSW 18 12905042 missense probably damaging 1.00
R8506:Osbpl1a UTSW 18 12768586 missense probably benign 0.02
R8947:Osbpl1a UTSW 18 12766801 critical splice donor site probably null
R9069:Osbpl1a UTSW 18 12869017 intron probably benign
R9085:Osbpl1a UTSW 18 12929036 missense probably damaging 1.00
R9288:Osbpl1a UTSW 18 12771345 missense probably damaging 1.00
R9443:Osbpl1a UTSW 18 12898187 missense probably benign 0.00
R9517:Osbpl1a UTSW 18 12909908 missense probably benign
R9600:Osbpl1a UTSW 18 12882220 missense probably benign 0.00
R9658:Osbpl1a UTSW 18 12756212 missense probably benign 0.05
R9694:Osbpl1a UTSW 18 12819508 missense probably benign 0.03
X0027:Osbpl1a UTSW 18 12759503 missense possibly damaging 0.46
Z1177:Osbpl1a UTSW 18 12906923 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGCTTCTCACTGGCCATGAG -3'
(R):5'- GGTCACTCAGGACATCCATGAC -3'

Sequencing Primer
(F):5'- TCACTGGCCATGAGCAGGG -3'
(R):5'- GGACATCCATGACACACAGAG -3'
Posted On 2019-05-13