Incidental Mutation 'R6998:Lgsn'
ID 544318
Institutional Source Beutler Lab
Gene Symbol Lgsn
Ensembl Gene ENSMUSG00000050217
Gene Name lengsin, lens protein with glutamine synthetase domain
Synonyms Gluld1, Lgs, lengsin
MMRRC Submission 045010-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.224) question?
Stock # R6998 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 31215482-31243806 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 31243274 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 452 (H452L)
Ref Sequence ENSEMBL: ENSMUSP00000059871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062560] [ENSMUST00000127775] [ENSMUST00000135245] [ENSMUST00000187659]
AlphaFold Q8CIX8
PDB Structure Lengsin is a survivor of an ancient family of class I glutamine synthetases in eukaryotes that has undergone evolutionary re- engineering for a tissue-specific role in the vertebrate eye lens. [ELECTRON MICROSCOPY]
Predicted Effect probably benign
Transcript: ENSMUST00000062560
AA Change: H452L

PolyPhen 2 Score 0.198 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000059871
Gene: ENSMUSG00000050217
AA Change: H452L

DomainStartEndE-ValueType
SCOP:d1f52a1 128 233 2e-20 SMART
Gln-synt_C 235 481 1.67e-39 SMART
low complexity region 483 496 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127775
SMART Domains Protein: ENSMUSP00000120381
Gene: ENSMUSG00000086727

DomainStartEndE-ValueType
low complexity region 55 68 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135245
SMART Domains Protein: ENSMUSP00000120289
Gene: ENSMUSG00000086727

DomainStartEndE-ValueType
low complexity region 55 68 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161773
Predicted Effect probably benign
Transcript: ENSMUST00000187659
SMART Domains Protein: ENSMUSP00000139710
Gene: ENSMUSG00000086727

DomainStartEndE-ValueType
low complexity region 55 68 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187892
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with similarity to the GS I members of the glutamine synthetase superfamily. The encoded protein is referred to as a pseudo-glutamine synthetase because it has no glutamine synthesis activity and may function as a chaperone protein. This protein is localized to the lens and may be associated with cataract disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam30 A G 3: 98,070,026 (GRCm39) R620G probably benign Het
Adcy1 A C 11: 7,029,026 (GRCm39) N259H probably damaging Het
Ahctf1 G A 1: 179,598,480 (GRCm39) R2* probably null Het
Akr1c21 A G 13: 4,633,850 (GRCm39) I306M probably benign Het
Alg9 T A 9: 50,700,921 (GRCm39) S230R possibly damaging Het
Armt1 T A 10: 4,403,937 (GRCm39) C341S probably benign Het
Aspg T A 12: 112,078,628 (GRCm39) L29M probably damaging Het
Aspm C T 1: 139,397,210 (GRCm39) T934I probably damaging Het
C1rl T C 6: 124,485,861 (GRCm39) S411P probably damaging Het
Card14 A G 11: 119,213,725 (GRCm39) E224G probably damaging Het
Ccdc88c T C 12: 100,883,111 (GRCm39) H1587R probably damaging Het
Ccp110 A G 7: 118,332,120 (GRCm39) T963A possibly damaging Het
Cdk11b G A 4: 155,732,800 (GRCm39) W546* probably null Het
Cyp8b1 T C 9: 121,745,059 (GRCm39) N91S probably benign Het
Dab2 G T 15: 6,454,130 (GRCm39) M213I possibly damaging Het
Decr1 A G 4: 15,930,960 (GRCm39) V124A probably damaging Het
Fbxl13 T A 5: 21,748,687 (GRCm39) I411F probably damaging Het
Fbxl13 T C 5: 21,825,611 (GRCm39) I164V probably null Het
Fndc7 G A 3: 108,783,964 (GRCm39) A215V probably benign Het
Garem2 T C 5: 30,319,168 (GRCm39) M210T possibly damaging Het
Gpatch2l G A 12: 86,290,958 (GRCm39) R47H probably damaging Het
Ighv1-52 C A 12: 115,109,112 (GRCm39) A115S probably benign Het
Igkv6-13 A G 6: 70,434,573 (GRCm39) S91P probably damaging Het
Ints8 T A 4: 11,204,537 (GRCm39) E973V possibly damaging Het
Itga3 T C 11: 94,942,288 (GRCm39) K972R probably benign Het
Klhl33 A T 14: 51,130,478 (GRCm39) F339I probably benign Het
Krt79 T C 15: 101,846,307 (GRCm39) M214V probably benign Het
Limd2 C T 11: 106,049,516 (GRCm39) G124D probably benign Het
Luzp1 T C 4: 136,270,755 (GRCm39) S993P probably damaging Het
Maml2 C T 9: 13,532,481 (GRCm39) probably benign Het
Mbtd1 A T 11: 93,815,438 (GRCm39) H342L probably damaging Het
Mfhas1 C A 8: 36,058,510 (GRCm39) P995Q probably damaging Het
Muc5ac T C 7: 141,372,451 (GRCm39) F3399S possibly damaging Het
Napb T C 2: 148,542,345 (GRCm39) Y205C probably damaging Het
Odf2 G T 2: 29,802,629 (GRCm39) A298S probably benign Het
Or11g7 A T 14: 50,690,890 (GRCm39) Y127F probably benign Het
Or4s2b A T 2: 88,508,852 (GRCm39) I218F probably benign Het
Or8k35 A T 2: 86,424,488 (GRCm39) M228K probably damaging Het
Pcsk5 T C 19: 17,450,476 (GRCm39) D1124G probably benign Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 (GRCm39) probably benign Het
Pik3c2b T G 1: 133,030,110 (GRCm39) I1457S probably benign Het
Pole2 T C 12: 69,260,680 (GRCm39) T167A possibly damaging Het
Rfx7 T A 9: 72,525,787 (GRCm39) S992R probably damaging Het
Ryr2 G T 13: 11,727,052 (GRCm39) S2436R probably damaging Het
Sgo2a A G 1: 58,055,799 (GRCm39) D661G probably damaging Het
Sh3glb2 T A 2: 30,245,333 (GRCm39) T49S probably damaging Het
Slc16a10 T C 10: 39,932,499 (GRCm39) K354R possibly damaging Het
Slc6a6 C A 6: 91,729,419 (GRCm39) T568K probably benign Het
Sptbn1 T C 11: 30,050,633 (GRCm39) T2319A probably damaging Het
Tbl1xr1 T A 3: 22,233,454 (GRCm39) Y15N probably damaging Het
Thyn1 T C 9: 26,917,738 (GRCm39) S160P probably damaging Het
Tshz1 A T 18: 84,033,966 (GRCm39) D147E probably benign Het
Vmn2r50 T G 7: 9,771,684 (GRCm39) R672S probably benign Het
Zfp663 A T 2: 165,195,922 (GRCm39) I99N possibly damaging Het
Other mutations in Lgsn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Lgsn APN 1 31,242,647 (GRCm39) missense possibly damaging 0.75
IGL01347:Lgsn APN 1 31,243,041 (GRCm39) missense probably damaging 1.00
IGL01688:Lgsn APN 1 31,243,486 (GRCm39) missense probably damaging 1.00
IGL02937:Lgsn APN 1 31,243,318 (GRCm39) missense possibly damaging 0.63
IGL03056:Lgsn APN 1 31,242,705 (GRCm39) nonsense probably null
R0026:Lgsn UTSW 1 31,242,524 (GRCm39) missense probably damaging 0.99
R0026:Lgsn UTSW 1 31,242,524 (GRCm39) missense probably damaging 0.99
R0042:Lgsn UTSW 1 31,229,534 (GRCm39) missense probably benign
R0042:Lgsn UTSW 1 31,229,534 (GRCm39) missense probably benign
R0611:Lgsn UTSW 1 31,242,736 (GRCm39) missense probably benign 0.01
R0905:Lgsn UTSW 1 31,242,824 (GRCm39) missense probably damaging 0.99
R2248:Lgsn UTSW 1 31,242,607 (GRCm39) missense possibly damaging 0.71
R3883:Lgsn UTSW 1 31,215,540 (GRCm39) missense probably benign 0.00
R4782:Lgsn UTSW 1 31,242,823 (GRCm39) missense probably benign 0.44
R5560:Lgsn UTSW 1 31,235,953 (GRCm39) missense probably damaging 1.00
R6011:Lgsn UTSW 1 31,242,847 (GRCm39) missense probably damaging 1.00
R7003:Lgsn UTSW 1 31,243,024 (GRCm39) missense possibly damaging 0.46
R7007:Lgsn UTSW 1 31,229,508 (GRCm39) missense probably benign 0.00
R7282:Lgsn UTSW 1 31,242,452 (GRCm39) missense probably damaging 1.00
R7620:Lgsn UTSW 1 31,242,461 (GRCm39) missense probably benign 0.00
R8082:Lgsn UTSW 1 31,243,273 (GRCm39) missense probably benign 0.17
R8220:Lgsn UTSW 1 31,235,881 (GRCm39) missense probably benign 0.00
R8467:Lgsn UTSW 1 31,242,731 (GRCm39) missense probably benign 0.45
R9312:Lgsn UTSW 1 31,243,280 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCACCGGGAAGAAGTGGTTG -3'
(R):5'- CAGACACTCATCTTGCTCCAG -3'

Sequencing Primer
(F):5'- GAAGTGGTTGGCAGGCC -3'
(R):5'- AGGGCATCTTCCATCTTCAAAGGG -3'
Posted On 2019-05-13