Incidental Mutation 'R6998:Ahctf1'
ID544322
Institutional Source Beutler Lab
Gene Symbol Ahctf1
Ensembl Gene ENSMUSG00000026491
Gene NameAT hook containing transcription factor 1
Synonyms6230412P20Rik, Elys
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6998 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location179744894-179803680 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 179770915 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 2 (R2*)
Ref Sequence ENSEMBL: ENSMUSP00000115795 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027768] [ENSMUST00000145968]
Predicted Effect probably null
Transcript: ENSMUST00000027768
AA Change: R897*
SMART Domains Protein: ENSMUSP00000027768
Gene: ENSMUSG00000026491
AA Change: R897*

DomainStartEndE-ValueType
Pfam:ELYS-bb 1 489 1.6e-307 PFAM
Pfam:ELYS 722 955 2.5e-58 PFAM
low complexity region 1138 1155 N/A INTRINSIC
low complexity region 1180 1192 N/A INTRINSIC
low complexity region 1352 1366 N/A INTRINSIC
low complexity region 1597 1610 N/A INTRINSIC
low complexity region 1684 1694 N/A INTRINSIC
low complexity region 1834 1841 N/A INTRINSIC
low complexity region 1918 1935 N/A INTRINSIC
AT_hook 1955 1967 3.35e-1 SMART
low complexity region 2060 2066 N/A INTRINSIC
low complexity region 2073 2084 N/A INTRINSIC
low complexity region 2096 2108 N/A INTRINSIC
Blast:KISc 2164 2217 2e-12 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000145968
AA Change: R2*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice die between E3.5 and E5.5. The inner cell mass cells exhibit impaired proliferation and apoptosis when grown in culture. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam30 A G 3: 98,162,710 R620G probably benign Het
Adcy1 A C 11: 7,079,026 N259H probably damaging Het
Akr1c21 A G 13: 4,583,851 I306M probably benign Het
Alg9 T A 9: 50,789,621 S230R possibly damaging Het
Armt1 T A 10: 4,453,937 C341S probably benign Het
Aspg T A 12: 112,112,194 L29M probably damaging Het
Aspm C T 1: 139,469,472 T934I probably damaging Het
C1rl T C 6: 124,508,902 S411P probably damaging Het
Card14 A G 11: 119,322,899 E224G probably damaging Het
Ccdc88c T C 12: 100,916,852 H1587R probably damaging Het
Ccp110 A G 7: 118,732,897 T963A possibly damaging Het
Cdk11b G A 4: 155,648,343 W546* probably null Het
Cyp8b1 T C 9: 121,915,993 N91S probably benign Het
Dab2 G T 15: 6,424,649 M213I possibly damaging Het
Decr1 A G 4: 15,930,960 V124A probably damaging Het
Fbxl13 T A 5: 21,543,689 I411F probably damaging Het
Fbxl13 T C 5: 21,620,613 I164V probably null Het
Fndc7 G A 3: 108,876,648 A215V probably benign Het
Garem2 T C 5: 30,114,170 M210T possibly damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Ighv1-52 C A 12: 115,145,492 A115S probably benign Het
Igkv6-13 A G 6: 70,457,589 S91P probably damaging Het
Ints8 T A 4: 11,204,537 E973V possibly damaging Het
Itga3 T C 11: 95,051,462 K972R probably benign Het
Klhl33 A T 14: 50,893,021 F339I probably benign Het
Krt79 T C 15: 101,937,872 M214V probably benign Het
Lgsn A T 1: 31,204,193 H452L probably benign Het
Limd2 C T 11: 106,158,690 G124D probably benign Het
Luzp1 T C 4: 136,543,444 S993P probably damaging Het
Maml2 C T 9: 13,621,185 probably benign Het
Mbtd1 A T 11: 93,924,612 H342L probably damaging Het
Mfhas1 C A 8: 35,591,356 P995Q probably damaging Het
Muc5ac T C 7: 141,818,714 F3399S possibly damaging Het
Napb T C 2: 148,700,425 Y205C probably damaging Het
Odf2 G T 2: 29,912,617 A298S probably benign Het
Olfr1082 A T 2: 86,594,144 M228K probably damaging Het
Olfr1193 A T 2: 88,678,508 I218F probably benign Het
Olfr740 A T 14: 50,453,433 Y127F probably benign Het
Pcsk5 T C 19: 17,473,112 D1124G probably benign Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pik3c2b T G 1: 133,102,372 I1457S probably benign Het
Pole2 T C 12: 69,213,906 T167A possibly damaging Het
Rfx7 T A 9: 72,618,505 S992R probably damaging Het
Ryr2 G T 13: 11,712,166 S2436R probably damaging Het
Sgo2a A G 1: 58,016,640 D661G probably damaging Het
Sh3glb2 T A 2: 30,355,321 T49S probably damaging Het
Slc16a10 T C 10: 40,056,503 K354R possibly damaging Het
Slc6a6 C A 6: 91,752,438 T568K probably benign Het
Sptbn1 T C 11: 30,100,633 T2319A probably damaging Het
Tbl1xr1 T A 3: 22,179,290 Y15N probably damaging Het
Thyn1 T C 9: 27,006,442 S160P probably damaging Het
Tshz1 A T 18: 84,015,841 D147E probably benign Het
Vmn2r50 T G 7: 10,037,757 R672S probably benign Het
Zfp663 A T 2: 165,354,002 I99N possibly damaging Het
Other mutations in Ahctf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00757:Ahctf1 APN 1 179769131 missense probably damaging 1.00
IGL01714:Ahctf1 APN 1 179795877 missense probably damaging 0.99
IGL01787:Ahctf1 APN 1 179753322 missense probably benign
IGL01997:Ahctf1 APN 1 179755462 missense probably damaging 0.99
IGL02035:Ahctf1 APN 1 179766014 missense probably benign 0.00
IGL02158:Ahctf1 APN 1 179779652 missense possibly damaging 0.64
IGL02182:Ahctf1 APN 1 179753078 missense probably benign 0.00
IGL02298:Ahctf1 APN 1 179752479 missense probably benign 0.00
IGL02325:Ahctf1 APN 1 179776015 missense probably benign 0.14
IGL02619:Ahctf1 APN 1 179792451 missense possibly damaging 0.90
IGL02858:Ahctf1 APN 1 179769034 missense probably damaging 0.96
IGL02893:Ahctf1 APN 1 179776011 nonsense probably null
IGL02895:Ahctf1 APN 1 179793811 missense probably damaging 1.00
IGL03180:Ahctf1 APN 1 179775330 critical splice donor site probably null
IGL03220:Ahctf1 APN 1 179788202 missense probably benign 0.01
cerebro UTSW 1 179769414 missense probably damaging 0.99
R0003:Ahctf1 UTSW 1 179763473 missense probably benign 0.04
R0024:Ahctf1 UTSW 1 179752436 missense probably damaging 0.98
R0030:Ahctf1 UTSW 1 179752436 missense probably damaging 0.98
R0432:Ahctf1 UTSW 1 179784161 missense probably damaging 0.98
R0481:Ahctf1 UTSW 1 179760271 missense probably benign 0.00
R0600:Ahctf1 UTSW 1 179763468 critical splice donor site probably null
R0613:Ahctf1 UTSW 1 179769414 missense probably damaging 0.99
R0814:Ahctf1 UTSW 1 179762908 missense probably benign 0.26
R1055:Ahctf1 UTSW 1 179763486 missense possibly damaging 0.46
R1473:Ahctf1 UTSW 1 179776108 missense probably benign 0.30
R1473:Ahctf1 UTSW 1 179799279 missense probably damaging 0.99
R1689:Ahctf1 UTSW 1 179768383 missense probably damaging 0.96
R1778:Ahctf1 UTSW 1 179753015 missense possibly damaging 0.57
R1878:Ahctf1 UTSW 1 179775509 missense possibly damaging 0.96
R1925:Ahctf1 UTSW 1 179770653 missense probably damaging 0.98
R2118:Ahctf1 UTSW 1 179769452 missense probably damaging 1.00
R2122:Ahctf1 UTSW 1 179769452 missense probably damaging 1.00
R2124:Ahctf1 UTSW 1 179769452 missense probably damaging 1.00
R2373:Ahctf1 UTSW 1 179795796 missense probably damaging 1.00
R2509:Ahctf1 UTSW 1 179770693 missense possibly damaging 0.51
R2697:Ahctf1 UTSW 1 179752532 missense probably damaging 0.99
R3035:Ahctf1 UTSW 1 179753870 missense probably damaging 1.00
R3155:Ahctf1 UTSW 1 179755583 missense probably damaging 0.98
R3899:Ahctf1 UTSW 1 179777780 missense possibly damaging 0.95
R4036:Ahctf1 UTSW 1 179762616 missense possibly damaging 0.61
R4681:Ahctf1 UTSW 1 179752796 missense probably benign 0.27
R4695:Ahctf1 UTSW 1 179753054 missense possibly damaging 0.78
R4735:Ahctf1 UTSW 1 179753399 missense probably benign 0.00
R4857:Ahctf1 UTSW 1 179799357 unclassified probably benign
R4898:Ahctf1 UTSW 1 179755512 missense probably benign 0.02
R4905:Ahctf1 UTSW 1 179748627 missense probably damaging 1.00
R5011:Ahctf1 UTSW 1 179784110 missense possibly damaging 0.92
R5013:Ahctf1 UTSW 1 179784110 missense possibly damaging 0.92
R5053:Ahctf1 UTSW 1 179786784 missense possibly damaging 0.82
R5207:Ahctf1 UTSW 1 179793594 intron probably benign
R5319:Ahctf1 UTSW 1 179769050 missense probably damaging 1.00
R5343:Ahctf1 UTSW 1 179770634 nonsense probably null
R5546:Ahctf1 UTSW 1 179754068 missense probably benign 0.01
R5718:Ahctf1 UTSW 1 179769339 missense possibly damaging 0.54
R5862:Ahctf1 UTSW 1 179788330 missense probably damaging 1.00
R5958:Ahctf1 UTSW 1 179746542 unclassified probably benign
R6010:Ahctf1 UTSW 1 179795813 missense possibly damaging 0.80
R6081:Ahctf1 UTSW 1 179781672 missense probably benign 0.07
R6093:Ahctf1 UTSW 1 179762952 missense probably benign 0.01
R6207:Ahctf1 UTSW 1 179777390 intron probably null
R6268:Ahctf1 UTSW 1 179763483 missense probably benign 0.08
R6656:Ahctf1 UTSW 1 179753513 missense probably benign 0.05
R6668:Ahctf1 UTSW 1 179752407 missense probably benign 0.04
R6788:Ahctf1 UTSW 1 179752634 missense probably benign 0.00
R6860:Ahctf1 UTSW 1 179753288 missense probably benign 0.04
R7082:Ahctf1 UTSW 1 179775333 missense probably benign 0.15
R7385:Ahctf1 UTSW 1 179753381 missense possibly damaging 0.66
R7414:Ahctf1 UTSW 1 179784105 missense probably benign 0.00
R7663:Ahctf1 UTSW 1 179790314 missense possibly damaging 0.66
R7673:Ahctf1 UTSW 1 179762846 missense probably benign 0.02
R7715:Ahctf1 UTSW 1 179770848 missense probably benign 0.00
R7819:Ahctf1 UTSW 1 179768315 missense probably benign
R7846:Ahctf1 UTSW 1 179787073 missense probably damaging 0.99
R7912:Ahctf1 UTSW 1 179753091 missense probably benign 0.00
R7929:Ahctf1 UTSW 1 179787073 missense probably damaging 0.99
R7993:Ahctf1 UTSW 1 179753091 missense probably benign 0.00
X0067:Ahctf1 UTSW 1 179777704 missense probably damaging 0.99
Z1177:Ahctf1 UTSW 1 179793730 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACTAAGCATTCCTAGGAAGAAC -3'
(R):5'- AGCTGCTTAAAATTGAGGTTCCC -3'

Sequencing Primer
(F):5'- GCATTCCTAGGAAGAACAAAGC -3'
(R):5'- TCCGTAACAGCTAGAGTGGATTCC -3'
Posted On2019-05-13