Incidental Mutation 'R6998:Ahctf1'
ID 544322
Institutional Source Beutler Lab
Gene Symbol Ahctf1
Ensembl Gene ENSMUSG00000026491
Gene Name AT hook containing transcription factor 1
Synonyms Elys, 6230412P20Rik
MMRRC Submission 045010-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6998 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 179572459-179631245 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 179598480 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 2 (R2*)
Ref Sequence ENSEMBL: ENSMUSP00000115795 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027768] [ENSMUST00000145968]
AlphaFold Q8CJF7
Predicted Effect probably null
Transcript: ENSMUST00000027768
AA Change: R897*
SMART Domains Protein: ENSMUSP00000027768
Gene: ENSMUSG00000026491
AA Change: R897*

DomainStartEndE-ValueType
Pfam:ELYS-bb 1 489 1.6e-307 PFAM
Pfam:ELYS 722 955 2.5e-58 PFAM
low complexity region 1138 1155 N/A INTRINSIC
low complexity region 1180 1192 N/A INTRINSIC
low complexity region 1352 1366 N/A INTRINSIC
low complexity region 1597 1610 N/A INTRINSIC
low complexity region 1684 1694 N/A INTRINSIC
low complexity region 1834 1841 N/A INTRINSIC
low complexity region 1918 1935 N/A INTRINSIC
AT_hook 1955 1967 3.35e-1 SMART
low complexity region 2060 2066 N/A INTRINSIC
low complexity region 2073 2084 N/A INTRINSIC
low complexity region 2096 2108 N/A INTRINSIC
Blast:KISc 2164 2217 2e-12 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000145968
AA Change: R2*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice die between E3.5 and E5.5. The inner cell mass cells exhibit impaired proliferation and apoptosis when grown in culture. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam30 A G 3: 98,070,026 (GRCm39) R620G probably benign Het
Adcy1 A C 11: 7,029,026 (GRCm39) N259H probably damaging Het
Akr1c21 A G 13: 4,633,850 (GRCm39) I306M probably benign Het
Alg9 T A 9: 50,700,921 (GRCm39) S230R possibly damaging Het
Armt1 T A 10: 4,403,937 (GRCm39) C341S probably benign Het
Aspg T A 12: 112,078,628 (GRCm39) L29M probably damaging Het
Aspm C T 1: 139,397,210 (GRCm39) T934I probably damaging Het
C1rl T C 6: 124,485,861 (GRCm39) S411P probably damaging Het
Card14 A G 11: 119,213,725 (GRCm39) E224G probably damaging Het
Ccdc88c T C 12: 100,883,111 (GRCm39) H1587R probably damaging Het
Ccp110 A G 7: 118,332,120 (GRCm39) T963A possibly damaging Het
Cdk11b G A 4: 155,732,800 (GRCm39) W546* probably null Het
Cyp8b1 T C 9: 121,745,059 (GRCm39) N91S probably benign Het
Dab2 G T 15: 6,454,130 (GRCm39) M213I possibly damaging Het
Decr1 A G 4: 15,930,960 (GRCm39) V124A probably damaging Het
Fbxl13 T A 5: 21,748,687 (GRCm39) I411F probably damaging Het
Fbxl13 T C 5: 21,825,611 (GRCm39) I164V probably null Het
Fndc7 G A 3: 108,783,964 (GRCm39) A215V probably benign Het
Garem2 T C 5: 30,319,168 (GRCm39) M210T possibly damaging Het
Gpatch2l G A 12: 86,290,958 (GRCm39) R47H probably damaging Het
Ighv1-52 C A 12: 115,109,112 (GRCm39) A115S probably benign Het
Igkv6-13 A G 6: 70,434,573 (GRCm39) S91P probably damaging Het
Ints8 T A 4: 11,204,537 (GRCm39) E973V possibly damaging Het
Itga3 T C 11: 94,942,288 (GRCm39) K972R probably benign Het
Klhl33 A T 14: 51,130,478 (GRCm39) F339I probably benign Het
Krt79 T C 15: 101,846,307 (GRCm39) M214V probably benign Het
Lgsn A T 1: 31,243,274 (GRCm39) H452L probably benign Het
Limd2 C T 11: 106,049,516 (GRCm39) G124D probably benign Het
Luzp1 T C 4: 136,270,755 (GRCm39) S993P probably damaging Het
Maml2 C T 9: 13,532,481 (GRCm39) probably benign Het
Mbtd1 A T 11: 93,815,438 (GRCm39) H342L probably damaging Het
Mfhas1 C A 8: 36,058,510 (GRCm39) P995Q probably damaging Het
Muc5ac T C 7: 141,372,451 (GRCm39) F3399S possibly damaging Het
Napb T C 2: 148,542,345 (GRCm39) Y205C probably damaging Het
Odf2 G T 2: 29,802,629 (GRCm39) A298S probably benign Het
Or11g7 A T 14: 50,690,890 (GRCm39) Y127F probably benign Het
Or4s2b A T 2: 88,508,852 (GRCm39) I218F probably benign Het
Or8k35 A T 2: 86,424,488 (GRCm39) M228K probably damaging Het
Pcsk5 T C 19: 17,450,476 (GRCm39) D1124G probably benign Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 (GRCm39) probably benign Het
Pik3c2b T G 1: 133,030,110 (GRCm39) I1457S probably benign Het
Pole2 T C 12: 69,260,680 (GRCm39) T167A possibly damaging Het
Rfx7 T A 9: 72,525,787 (GRCm39) S992R probably damaging Het
Ryr2 G T 13: 11,727,052 (GRCm39) S2436R probably damaging Het
Sgo2a A G 1: 58,055,799 (GRCm39) D661G probably damaging Het
Sh3glb2 T A 2: 30,245,333 (GRCm39) T49S probably damaging Het
Slc16a10 T C 10: 39,932,499 (GRCm39) K354R possibly damaging Het
Slc6a6 C A 6: 91,729,419 (GRCm39) T568K probably benign Het
Sptbn1 T C 11: 30,050,633 (GRCm39) T2319A probably damaging Het
Tbl1xr1 T A 3: 22,233,454 (GRCm39) Y15N probably damaging Het
Thyn1 T C 9: 26,917,738 (GRCm39) S160P probably damaging Het
Tshz1 A T 18: 84,033,966 (GRCm39) D147E probably benign Het
Vmn2r50 T G 7: 9,771,684 (GRCm39) R672S probably benign Het
Zfp663 A T 2: 165,195,922 (GRCm39) I99N possibly damaging Het
Other mutations in Ahctf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00757:Ahctf1 APN 1 179,596,696 (GRCm39) missense probably damaging 1.00
IGL01714:Ahctf1 APN 1 179,623,442 (GRCm39) missense probably damaging 0.99
IGL01787:Ahctf1 APN 1 179,580,887 (GRCm39) missense probably benign
IGL01997:Ahctf1 APN 1 179,583,027 (GRCm39) missense probably damaging 0.99
IGL02035:Ahctf1 APN 1 179,593,579 (GRCm39) missense probably benign 0.00
IGL02158:Ahctf1 APN 1 179,607,217 (GRCm39) missense possibly damaging 0.64
IGL02182:Ahctf1 APN 1 179,580,643 (GRCm39) missense probably benign 0.00
IGL02298:Ahctf1 APN 1 179,580,044 (GRCm39) missense probably benign 0.00
IGL02325:Ahctf1 APN 1 179,603,580 (GRCm39) missense probably benign 0.14
IGL02619:Ahctf1 APN 1 179,620,016 (GRCm39) missense possibly damaging 0.90
IGL02858:Ahctf1 APN 1 179,596,599 (GRCm39) missense probably damaging 0.96
IGL02893:Ahctf1 APN 1 179,603,576 (GRCm39) nonsense probably null
IGL02895:Ahctf1 APN 1 179,621,376 (GRCm39) missense probably damaging 1.00
IGL03180:Ahctf1 APN 1 179,602,895 (GRCm39) critical splice donor site probably null
IGL03220:Ahctf1 APN 1 179,615,767 (GRCm39) missense probably benign 0.01
cerebro UTSW 1 179,596,979 (GRCm39) missense probably damaging 0.99
R0003:Ahctf1 UTSW 1 179,591,038 (GRCm39) missense probably benign 0.04
R0024:Ahctf1 UTSW 1 179,580,001 (GRCm39) missense probably damaging 0.98
R0030:Ahctf1 UTSW 1 179,580,001 (GRCm39) missense probably damaging 0.98
R0432:Ahctf1 UTSW 1 179,611,726 (GRCm39) missense probably damaging 0.98
R0481:Ahctf1 UTSW 1 179,587,836 (GRCm39) missense probably benign 0.00
R0600:Ahctf1 UTSW 1 179,591,033 (GRCm39) critical splice donor site probably null
R0613:Ahctf1 UTSW 1 179,596,979 (GRCm39) missense probably damaging 0.99
R0814:Ahctf1 UTSW 1 179,590,473 (GRCm39) missense probably benign 0.26
R1055:Ahctf1 UTSW 1 179,591,051 (GRCm39) missense possibly damaging 0.46
R1473:Ahctf1 UTSW 1 179,626,844 (GRCm39) missense probably damaging 0.99
R1473:Ahctf1 UTSW 1 179,603,673 (GRCm39) missense probably benign 0.30
R1689:Ahctf1 UTSW 1 179,595,948 (GRCm39) missense probably damaging 0.96
R1778:Ahctf1 UTSW 1 179,580,580 (GRCm39) missense possibly damaging 0.57
R1878:Ahctf1 UTSW 1 179,603,074 (GRCm39) missense possibly damaging 0.96
R1925:Ahctf1 UTSW 1 179,598,218 (GRCm39) missense probably damaging 0.98
R2118:Ahctf1 UTSW 1 179,597,017 (GRCm39) missense probably damaging 1.00
R2122:Ahctf1 UTSW 1 179,597,017 (GRCm39) missense probably damaging 1.00
R2124:Ahctf1 UTSW 1 179,597,017 (GRCm39) missense probably damaging 1.00
R2373:Ahctf1 UTSW 1 179,623,361 (GRCm39) missense probably damaging 1.00
R2509:Ahctf1 UTSW 1 179,598,258 (GRCm39) missense possibly damaging 0.51
R2697:Ahctf1 UTSW 1 179,580,097 (GRCm39) missense probably damaging 0.99
R3035:Ahctf1 UTSW 1 179,581,435 (GRCm39) missense probably damaging 1.00
R3155:Ahctf1 UTSW 1 179,583,148 (GRCm39) missense probably damaging 0.98
R3899:Ahctf1 UTSW 1 179,605,345 (GRCm39) missense possibly damaging 0.95
R4036:Ahctf1 UTSW 1 179,590,181 (GRCm39) missense possibly damaging 0.61
R4681:Ahctf1 UTSW 1 179,580,361 (GRCm39) missense probably benign 0.27
R4695:Ahctf1 UTSW 1 179,580,619 (GRCm39) missense possibly damaging 0.78
R4735:Ahctf1 UTSW 1 179,580,964 (GRCm39) missense probably benign 0.00
R4857:Ahctf1 UTSW 1 179,626,922 (GRCm39) unclassified probably benign
R4898:Ahctf1 UTSW 1 179,583,077 (GRCm39) missense probably benign 0.02
R4905:Ahctf1 UTSW 1 179,576,192 (GRCm39) missense probably damaging 1.00
R5011:Ahctf1 UTSW 1 179,611,675 (GRCm39) missense possibly damaging 0.92
R5013:Ahctf1 UTSW 1 179,611,675 (GRCm39) missense possibly damaging 0.92
R5053:Ahctf1 UTSW 1 179,614,349 (GRCm39) missense possibly damaging 0.82
R5207:Ahctf1 UTSW 1 179,621,159 (GRCm39) intron probably benign
R5319:Ahctf1 UTSW 1 179,596,615 (GRCm39) missense probably damaging 1.00
R5343:Ahctf1 UTSW 1 179,598,199 (GRCm39) nonsense probably null
R5546:Ahctf1 UTSW 1 179,581,633 (GRCm39) missense probably benign 0.01
R5718:Ahctf1 UTSW 1 179,596,904 (GRCm39) missense possibly damaging 0.54
R5862:Ahctf1 UTSW 1 179,615,895 (GRCm39) missense probably damaging 1.00
R5958:Ahctf1 UTSW 1 179,574,107 (GRCm39) unclassified probably benign
R6010:Ahctf1 UTSW 1 179,623,378 (GRCm39) missense possibly damaging 0.80
R6081:Ahctf1 UTSW 1 179,609,237 (GRCm39) missense probably benign 0.07
R6093:Ahctf1 UTSW 1 179,590,517 (GRCm39) missense probably benign 0.01
R6207:Ahctf1 UTSW 1 179,604,955 (GRCm39) splice site probably null
R6268:Ahctf1 UTSW 1 179,591,048 (GRCm39) missense probably benign 0.08
R6656:Ahctf1 UTSW 1 179,581,078 (GRCm39) missense probably benign 0.05
R6668:Ahctf1 UTSW 1 179,579,972 (GRCm39) missense probably benign 0.04
R6788:Ahctf1 UTSW 1 179,580,199 (GRCm39) missense probably benign 0.00
R6860:Ahctf1 UTSW 1 179,580,853 (GRCm39) missense probably benign 0.04
R7082:Ahctf1 UTSW 1 179,602,898 (GRCm39) missense probably benign 0.15
R7385:Ahctf1 UTSW 1 179,580,946 (GRCm39) missense possibly damaging 0.66
R7414:Ahctf1 UTSW 1 179,611,670 (GRCm39) missense probably benign 0.00
R7663:Ahctf1 UTSW 1 179,617,879 (GRCm39) missense possibly damaging 0.66
R7673:Ahctf1 UTSW 1 179,590,411 (GRCm39) missense probably benign 0.02
R7715:Ahctf1 UTSW 1 179,598,413 (GRCm39) missense probably benign 0.00
R7819:Ahctf1 UTSW 1 179,595,880 (GRCm39) missense probably benign
R7846:Ahctf1 UTSW 1 179,614,638 (GRCm39) missense probably damaging 0.99
R7912:Ahctf1 UTSW 1 179,580,656 (GRCm39) missense probably benign 0.00
R7942:Ahctf1 UTSW 1 179,613,660 (GRCm39) missense possibly damaging 0.66
R8282:Ahctf1 UTSW 1 179,605,371 (GRCm39) missense possibly damaging 0.68
R8376:Ahctf1 UTSW 1 179,610,520 (GRCm39) missense probably damaging 0.99
R8439:Ahctf1 UTSW 1 179,590,175 (GRCm39) missense possibly damaging 0.89
R8482:Ahctf1 UTSW 1 179,591,107 (GRCm39) unclassified probably benign
R8683:Ahctf1 UTSW 1 179,623,321 (GRCm39) missense possibly damaging 0.70
R8734:Ahctf1 UTSW 1 179,608,430 (GRCm39) nonsense probably null
R8855:Ahctf1 UTSW 1 179,614,341 (GRCm39) missense probably damaging 0.99
R8928:Ahctf1 UTSW 1 179,596,626 (GRCm39) missense possibly damaging 0.49
R9009:Ahctf1 UTSW 1 179,581,171 (GRCm39) missense probably benign 0.11
R9106:Ahctf1 UTSW 1 179,614,601 (GRCm39) missense probably benign 0.04
R9228:Ahctf1 UTSW 1 179,611,685 (GRCm39) missense probably benign 0.28
R9408:Ahctf1 UTSW 1 179,603,638 (GRCm39) missense possibly damaging 0.46
R9800:Ahctf1 UTSW 1 179,581,433 (GRCm39) missense possibly damaging 0.77
X0067:Ahctf1 UTSW 1 179,605,269 (GRCm39) missense probably damaging 0.99
Z1177:Ahctf1 UTSW 1 179,621,295 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACTAAGCATTCCTAGGAAGAAC -3'
(R):5'- AGCTGCTTAAAATTGAGGTTCCC -3'

Sequencing Primer
(F):5'- GCATTCCTAGGAAGAACAAAGC -3'
(R):5'- TCCGTAACAGCTAGAGTGGATTCC -3'
Posted On 2019-05-13