Incidental Mutation 'R6998:Or8k35'
ID 544325
Institutional Source Beutler Lab
Gene Symbol Or8k35
Ensembl Gene ENSMUSG00000111689
Gene Name olfactory receptor family 8 subfamily K member 35
Synonyms MOR192-4_p, GA_x6K02T2Q125-48079993-48079157, Olfr1082
MMRRC Submission 045010-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.398) question?
Stock # R6998 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 86424229-86429153 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 86424488 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 228 (M228K)
Ref Sequence ENSEMBL: ENSMUSP00000150706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000215600]
AlphaFold A0A1L1SUC9
Predicted Effect probably damaging
Transcript: ENSMUST00000215600
AA Change: M228K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam30 A G 3: 98,070,026 (GRCm39) R620G probably benign Het
Adcy1 A C 11: 7,029,026 (GRCm39) N259H probably damaging Het
Ahctf1 G A 1: 179,598,480 (GRCm39) R2* probably null Het
Akr1c21 A G 13: 4,633,850 (GRCm39) I306M probably benign Het
Alg9 T A 9: 50,700,921 (GRCm39) S230R possibly damaging Het
Armt1 T A 10: 4,403,937 (GRCm39) C341S probably benign Het
Aspg T A 12: 112,078,628 (GRCm39) L29M probably damaging Het
Aspm C T 1: 139,397,210 (GRCm39) T934I probably damaging Het
C1rl T C 6: 124,485,861 (GRCm39) S411P probably damaging Het
Card14 A G 11: 119,213,725 (GRCm39) E224G probably damaging Het
Ccdc88c T C 12: 100,883,111 (GRCm39) H1587R probably damaging Het
Ccp110 A G 7: 118,332,120 (GRCm39) T963A possibly damaging Het
Cdk11b G A 4: 155,732,800 (GRCm39) W546* probably null Het
Cyp8b1 T C 9: 121,745,059 (GRCm39) N91S probably benign Het
Dab2 G T 15: 6,454,130 (GRCm39) M213I possibly damaging Het
Decr1 A G 4: 15,930,960 (GRCm39) V124A probably damaging Het
Fbxl13 T A 5: 21,748,687 (GRCm39) I411F probably damaging Het
Fbxl13 T C 5: 21,825,611 (GRCm39) I164V probably null Het
Fndc7 G A 3: 108,783,964 (GRCm39) A215V probably benign Het
Garem2 T C 5: 30,319,168 (GRCm39) M210T possibly damaging Het
Gpatch2l G A 12: 86,290,958 (GRCm39) R47H probably damaging Het
Ighv1-52 C A 12: 115,109,112 (GRCm39) A115S probably benign Het
Igkv6-13 A G 6: 70,434,573 (GRCm39) S91P probably damaging Het
Ints8 T A 4: 11,204,537 (GRCm39) E973V possibly damaging Het
Itga3 T C 11: 94,942,288 (GRCm39) K972R probably benign Het
Klhl33 A T 14: 51,130,478 (GRCm39) F339I probably benign Het
Krt79 T C 15: 101,846,307 (GRCm39) M214V probably benign Het
Lgsn A T 1: 31,243,274 (GRCm39) H452L probably benign Het
Limd2 C T 11: 106,049,516 (GRCm39) G124D probably benign Het
Luzp1 T C 4: 136,270,755 (GRCm39) S993P probably damaging Het
Maml2 C T 9: 13,532,481 (GRCm39) probably benign Het
Mbtd1 A T 11: 93,815,438 (GRCm39) H342L probably damaging Het
Mfhas1 C A 8: 36,058,510 (GRCm39) P995Q probably damaging Het
Muc5ac T C 7: 141,372,451 (GRCm39) F3399S possibly damaging Het
Napb T C 2: 148,542,345 (GRCm39) Y205C probably damaging Het
Odf2 G T 2: 29,802,629 (GRCm39) A298S probably benign Het
Or11g7 A T 14: 50,690,890 (GRCm39) Y127F probably benign Het
Or4s2b A T 2: 88,508,852 (GRCm39) I218F probably benign Het
Pcsk5 T C 19: 17,450,476 (GRCm39) D1124G probably benign Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 (GRCm39) probably benign Het
Pik3c2b T G 1: 133,030,110 (GRCm39) I1457S probably benign Het
Pole2 T C 12: 69,260,680 (GRCm39) T167A possibly damaging Het
Rfx7 T A 9: 72,525,787 (GRCm39) S992R probably damaging Het
Ryr2 G T 13: 11,727,052 (GRCm39) S2436R probably damaging Het
Sgo2a A G 1: 58,055,799 (GRCm39) D661G probably damaging Het
Sh3glb2 T A 2: 30,245,333 (GRCm39) T49S probably damaging Het
Slc16a10 T C 10: 39,932,499 (GRCm39) K354R possibly damaging Het
Slc6a6 C A 6: 91,729,419 (GRCm39) T568K probably benign Het
Sptbn1 T C 11: 30,050,633 (GRCm39) T2319A probably damaging Het
Tbl1xr1 T A 3: 22,233,454 (GRCm39) Y15N probably damaging Het
Thyn1 T C 9: 26,917,738 (GRCm39) S160P probably damaging Het
Tshz1 A T 18: 84,033,966 (GRCm39) D147E probably benign Het
Vmn2r50 T G 7: 9,771,684 (GRCm39) R672S probably benign Het
Zfp663 A T 2: 165,195,922 (GRCm39) I99N possibly damaging Het
Other mutations in Or8k35
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0483:Or8k35 UTSW 2 86,424,752 (GRCm39) missense probably benign 0.07
R0675:Or8k35 UTSW 2 86,424,423 (GRCm39) missense probably benign 0.00
R0718:Or8k35 UTSW 2 86,424,425 (GRCm39) missense probably benign 0.01
R0727:Or8k35 UTSW 2 86,424,724 (GRCm39) nonsense probably null
R1517:Or8k35 UTSW 2 86,424,948 (GRCm39) missense probably damaging 0.99
R1850:Or8k35 UTSW 2 86,424,448 (GRCm39) nonsense probably null
R2430:Or8k35 UTSW 2 86,425,052 (GRCm39) missense probably benign 0.00
R2474:Or8k35 UTSW 2 86,424,957 (GRCm39) missense probably benign 0.00
R3009:Or8k35 UTSW 2 86,424,714 (GRCm39) missense probably benign 0.07
R3122:Or8k35 UTSW 2 86,424,954 (GRCm39) missense possibly damaging 0.91
R4006:Or8k35 UTSW 2 86,424,908 (GRCm39) missense probably benign 0.14
R4007:Or8k35 UTSW 2 86,424,908 (GRCm39) missense probably benign 0.14
R4581:Or8k35 UTSW 2 86,424,572 (GRCm39) missense probably benign 0.08
R4762:Or8k35 UTSW 2 86,424,381 (GRCm39) missense possibly damaging 0.60
R5617:Or8k35 UTSW 2 86,424,345 (GRCm39) missense probably benign 0.07
R6118:Or8k35 UTSW 2 86,424,758 (GRCm39) missense probably benign
R6140:Or8k35 UTSW 2 86,424,448 (GRCm39) nonsense probably null
R6313:Or8k35 UTSW 2 86,424,411 (GRCm39) missense possibly damaging 0.76
R6528:Or8k35 UTSW 2 86,424,809 (GRCm39) missense probably damaging 1.00
R6785:Or8k35 UTSW 2 86,424,765 (GRCm39) missense probably damaging 0.98
R6792:Or8k35 UTSW 2 86,424,283 (GRCm39) missense probably benign 0.09
R6857:Or8k35 UTSW 2 86,424,608 (GRCm39) missense probably damaging 1.00
R7241:Or8k35 UTSW 2 86,424,498 (GRCm39) missense possibly damaging 0.89
R8790:Or8k35 UTSW 2 86,424,278 (GRCm39) missense possibly damaging 0.76
R8865:Or8k35 UTSW 2 86,424,744 (GRCm39) missense possibly damaging 0.89
R9521:Or8k35 UTSW 2 86,424,771 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- TGCCATGTTCTTTGTAGAGCATC -3'
(R):5'- TGGCTACAATGTCATCAACCATTTC -3'

Sequencing Primer
(F):5'- ACATCTTTGTTCCTCAGACTGTAG -3'
(R):5'- CAATGTCATCAACCATTTCTTTTGTG -3'
Posted On 2019-05-13