Incidental Mutation 'R6998:Zfp663'
ID 544328
Institutional Source Beutler Lab
Gene Symbol Zfp663
Ensembl Gene ENSMUSG00000056824
Gene Name zinc finger protein 663
Synonyms LOC381405, Gm1008
MMRRC Submission 045010-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.068) question?
Stock # R6998 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 165193217-165210649 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 165195922 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 99 (I99N)
Ref Sequence ENSEMBL: ENSMUSP00000099374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073062] [ENSMUST00000103085] [ENSMUST00000141140]
AlphaFold Q6NXM6
Predicted Effect possibly damaging
Transcript: ENSMUST00000073062
AA Change: I99N

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000072813
Gene: ENSMUSG00000056824
AA Change: I99N

DomainStartEndE-ValueType
KRAB 8 68 1.97e-31 SMART
ZnF_C2H2 205 227 3.47e1 SMART
ZnF_C2H2 472 494 2.4e-3 SMART
ZnF_C2H2 500 522 2.99e-4 SMART
ZnF_C2H2 528 550 2.43e-4 SMART
ZnF_C2H2 556 578 4.79e-3 SMART
ZnF_C2H2 584 606 3.95e-4 SMART
ZnF_C2H2 612 635 8.6e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000103085
AA Change: I99N

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000099374
Gene: ENSMUSG00000056824
AA Change: I99N

DomainStartEndE-ValueType
KRAB 8 68 1.97e-31 SMART
ZnF_C2H2 205 227 3.47e1 SMART
ZnF_C2H2 472 494 2.4e-3 SMART
ZnF_C2H2 500 522 2.99e-4 SMART
ZnF_C2H2 528 550 2.43e-4 SMART
ZnF_C2H2 556 578 4.79e-3 SMART
ZnF_C2H2 584 606 3.95e-4 SMART
ZnF_C2H2 612 635 8.6e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141140
SMART Domains Protein: ENSMUSP00000115254
Gene: ENSMUSG00000056824

DomainStartEndE-ValueType
KRAB 8 68 1.97e-31 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam30 A G 3: 98,070,026 (GRCm39) R620G probably benign Het
Adcy1 A C 11: 7,029,026 (GRCm39) N259H probably damaging Het
Ahctf1 G A 1: 179,598,480 (GRCm39) R2* probably null Het
Akr1c21 A G 13: 4,633,850 (GRCm39) I306M probably benign Het
Alg9 T A 9: 50,700,921 (GRCm39) S230R possibly damaging Het
Armt1 T A 10: 4,403,937 (GRCm39) C341S probably benign Het
Aspg T A 12: 112,078,628 (GRCm39) L29M probably damaging Het
Aspm C T 1: 139,397,210 (GRCm39) T934I probably damaging Het
C1rl T C 6: 124,485,861 (GRCm39) S411P probably damaging Het
Card14 A G 11: 119,213,725 (GRCm39) E224G probably damaging Het
Ccdc88c T C 12: 100,883,111 (GRCm39) H1587R probably damaging Het
Ccp110 A G 7: 118,332,120 (GRCm39) T963A possibly damaging Het
Cdk11b G A 4: 155,732,800 (GRCm39) W546* probably null Het
Cyp8b1 T C 9: 121,745,059 (GRCm39) N91S probably benign Het
Dab2 G T 15: 6,454,130 (GRCm39) M213I possibly damaging Het
Decr1 A G 4: 15,930,960 (GRCm39) V124A probably damaging Het
Fbxl13 T A 5: 21,748,687 (GRCm39) I411F probably damaging Het
Fbxl13 T C 5: 21,825,611 (GRCm39) I164V probably null Het
Fndc7 G A 3: 108,783,964 (GRCm39) A215V probably benign Het
Garem2 T C 5: 30,319,168 (GRCm39) M210T possibly damaging Het
Gpatch2l G A 12: 86,290,958 (GRCm39) R47H probably damaging Het
Ighv1-52 C A 12: 115,109,112 (GRCm39) A115S probably benign Het
Igkv6-13 A G 6: 70,434,573 (GRCm39) S91P probably damaging Het
Ints8 T A 4: 11,204,537 (GRCm39) E973V possibly damaging Het
Itga3 T C 11: 94,942,288 (GRCm39) K972R probably benign Het
Klhl33 A T 14: 51,130,478 (GRCm39) F339I probably benign Het
Krt79 T C 15: 101,846,307 (GRCm39) M214V probably benign Het
Lgsn A T 1: 31,243,274 (GRCm39) H452L probably benign Het
Limd2 C T 11: 106,049,516 (GRCm39) G124D probably benign Het
Luzp1 T C 4: 136,270,755 (GRCm39) S993P probably damaging Het
Maml2 C T 9: 13,532,481 (GRCm39) probably benign Het
Mbtd1 A T 11: 93,815,438 (GRCm39) H342L probably damaging Het
Mfhas1 C A 8: 36,058,510 (GRCm39) P995Q probably damaging Het
Muc5ac T C 7: 141,372,451 (GRCm39) F3399S possibly damaging Het
Napb T C 2: 148,542,345 (GRCm39) Y205C probably damaging Het
Odf2 G T 2: 29,802,629 (GRCm39) A298S probably benign Het
Or11g7 A T 14: 50,690,890 (GRCm39) Y127F probably benign Het
Or4s2b A T 2: 88,508,852 (GRCm39) I218F probably benign Het
Or8k35 A T 2: 86,424,488 (GRCm39) M228K probably damaging Het
Pcsk5 T C 19: 17,450,476 (GRCm39) D1124G probably benign Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 (GRCm39) probably benign Het
Pik3c2b T G 1: 133,030,110 (GRCm39) I1457S probably benign Het
Pole2 T C 12: 69,260,680 (GRCm39) T167A possibly damaging Het
Rfx7 T A 9: 72,525,787 (GRCm39) S992R probably damaging Het
Ryr2 G T 13: 11,727,052 (GRCm39) S2436R probably damaging Het
Sgo2a A G 1: 58,055,799 (GRCm39) D661G probably damaging Het
Sh3glb2 T A 2: 30,245,333 (GRCm39) T49S probably damaging Het
Slc16a10 T C 10: 39,932,499 (GRCm39) K354R possibly damaging Het
Slc6a6 C A 6: 91,729,419 (GRCm39) T568K probably benign Het
Sptbn1 T C 11: 30,050,633 (GRCm39) T2319A probably damaging Het
Tbl1xr1 T A 3: 22,233,454 (GRCm39) Y15N probably damaging Het
Thyn1 T C 9: 26,917,738 (GRCm39) S160P probably damaging Het
Tshz1 A T 18: 84,033,966 (GRCm39) D147E probably benign Het
Vmn2r50 T G 7: 9,771,684 (GRCm39) R672S probably benign Het
Other mutations in Zfp663
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00720:Zfp663 APN 2 165,194,525 (GRCm39) missense probably damaging 1.00
IGL01382:Zfp663 APN 2 165,200,935 (GRCm39) missense probably damaging 1.00
IGL02007:Zfp663 APN 2 165,200,993 (GRCm39) missense probably benign 0.12
IGL02164:Zfp663 APN 2 165,200,968 (GRCm39) nonsense probably null
IGL02506:Zfp663 APN 2 165,195,871 (GRCm39) missense probably benign 0.35
IGL03173:Zfp663 APN 2 165,194,419 (GRCm39) missense probably damaging 0.99
R0735:Zfp663 UTSW 2 165,200,995 (GRCm39) missense probably damaging 0.97
R1395:Zfp663 UTSW 2 165,194,492 (GRCm39) missense probably damaging 1.00
R1402:Zfp663 UTSW 2 165,195,890 (GRCm39) missense probably benign 0.14
R1402:Zfp663 UTSW 2 165,195,890 (GRCm39) missense probably benign 0.14
R1503:Zfp663 UTSW 2 165,194,573 (GRCm39) missense probably damaging 0.99
R1587:Zfp663 UTSW 2 165,195,437 (GRCm39) missense probably benign
R1854:Zfp663 UTSW 2 165,195,211 (GRCm39) missense probably benign 0.18
R1867:Zfp663 UTSW 2 165,194,651 (GRCm39) missense possibly damaging 0.74
R3031:Zfp663 UTSW 2 165,195,616 (GRCm39) nonsense probably null
R4643:Zfp663 UTSW 2 165,194,925 (GRCm39) missense probably benign 0.24
R4691:Zfp663 UTSW 2 165,201,050 (GRCm39) intron probably benign
R4977:Zfp663 UTSW 2 165,195,731 (GRCm39) missense probably damaging 0.97
R5135:Zfp663 UTSW 2 165,195,590 (GRCm39) missense possibly damaging 0.95
R5151:Zfp663 UTSW 2 165,195,113 (GRCm39) missense probably benign 0.00
R5639:Zfp663 UTSW 2 165,194,929 (GRCm39) missense probably benign 0.03
R5763:Zfp663 UTSW 2 165,200,355 (GRCm39) nonsense probably null
R6776:Zfp663 UTSW 2 165,200,935 (GRCm39) missense probably damaging 1.00
R6929:Zfp663 UTSW 2 165,195,178 (GRCm39) missense probably benign
R7035:Zfp663 UTSW 2 165,195,023 (GRCm39) missense probably benign 0.36
R7169:Zfp663 UTSW 2 165,194,359 (GRCm39) missense probably benign 0.00
R7529:Zfp663 UTSW 2 165,194,728 (GRCm39) missense probably damaging 1.00
R7790:Zfp663 UTSW 2 165,194,453 (GRCm39) missense probably damaging 1.00
R8087:Zfp663 UTSW 2 165,195,679 (GRCm39) missense probably benign 0.20
R8715:Zfp663 UTSW 2 165,194,644 (GRCm39) missense probably damaging 1.00
R8934:Zfp663 UTSW 2 165,194,714 (GRCm39) missense probably damaging 1.00
R8966:Zfp663 UTSW 2 165,194,958 (GRCm39) missense probably damaging 1.00
R9257:Zfp663 UTSW 2 165,195,974 (GRCm39) missense probably benign 0.00
R9278:Zfp663 UTSW 2 165,202,010 (GRCm39) critical splice acceptor site probably null
R9524:Zfp663 UTSW 2 165,195,607 (GRCm39) missense probably damaging 0.99
RF004:Zfp663 UTSW 2 165,200,363 (GRCm39) missense probably benign 0.00
Z1177:Zfp663 UTSW 2 165,195,033 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGAGATCTTTCATCAGGCGACC -3'
(R):5'- TGCGTCAGAACCCCAGAATC -3'

Sequencing Primer
(F):5'- GACCTGGAGCCACCTAAAC -3'
(R):5'- CCTGGTCTACAAAGTGAGTTCCAG -3'
Posted On 2019-05-13