Incidental Mutation 'R6998:Zfp663'
ID544328
Institutional Source Beutler Lab
Gene Symbol Zfp663
Ensembl Gene ENSMUSG00000056824
Gene Namezinc finger protein 663
SynonymsGm1008, LOC381405
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R6998 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location165351297-165368729 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 165354002 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 99 (I99N)
Ref Sequence ENSEMBL: ENSMUSP00000099374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073062] [ENSMUST00000103085] [ENSMUST00000141140]
Predicted Effect possibly damaging
Transcript: ENSMUST00000073062
AA Change: I99N

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000072813
Gene: ENSMUSG00000056824
AA Change: I99N

DomainStartEndE-ValueType
KRAB 8 68 1.97e-31 SMART
ZnF_C2H2 205 227 3.47e1 SMART
ZnF_C2H2 472 494 2.4e-3 SMART
ZnF_C2H2 500 522 2.99e-4 SMART
ZnF_C2H2 528 550 2.43e-4 SMART
ZnF_C2H2 556 578 4.79e-3 SMART
ZnF_C2H2 584 606 3.95e-4 SMART
ZnF_C2H2 612 635 8.6e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000103085
AA Change: I99N

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000099374
Gene: ENSMUSG00000056824
AA Change: I99N

DomainStartEndE-ValueType
KRAB 8 68 1.97e-31 SMART
ZnF_C2H2 205 227 3.47e1 SMART
ZnF_C2H2 472 494 2.4e-3 SMART
ZnF_C2H2 500 522 2.99e-4 SMART
ZnF_C2H2 528 550 2.43e-4 SMART
ZnF_C2H2 556 578 4.79e-3 SMART
ZnF_C2H2 584 606 3.95e-4 SMART
ZnF_C2H2 612 635 8.6e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141140
SMART Domains Protein: ENSMUSP00000115254
Gene: ENSMUSG00000056824

DomainStartEndE-ValueType
KRAB 8 68 1.97e-31 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam30 A G 3: 98,162,710 R620G probably benign Het
Adcy1 A C 11: 7,079,026 N259H probably damaging Het
Ahctf1 G A 1: 179,770,915 R2* probably null Het
Akr1c21 A G 13: 4,583,851 I306M probably benign Het
Alg9 T A 9: 50,789,621 S230R possibly damaging Het
Armt1 T A 10: 4,453,937 C341S probably benign Het
Aspg T A 12: 112,112,194 L29M probably damaging Het
Aspm C T 1: 139,469,472 T934I probably damaging Het
C1rl T C 6: 124,508,902 S411P probably damaging Het
Card14 A G 11: 119,322,899 E224G probably damaging Het
Ccdc88c T C 12: 100,916,852 H1587R probably damaging Het
Ccp110 A G 7: 118,732,897 T963A possibly damaging Het
Cdk11b G A 4: 155,648,343 W546* probably null Het
Cyp8b1 T C 9: 121,915,993 N91S probably benign Het
Dab2 G T 15: 6,424,649 M213I possibly damaging Het
Decr1 A G 4: 15,930,960 V124A probably damaging Het
Fbxl13 T A 5: 21,543,689 I411F probably damaging Het
Fbxl13 T C 5: 21,620,613 I164V probably null Het
Fndc7 G A 3: 108,876,648 A215V probably benign Het
Garem2 T C 5: 30,114,170 M210T possibly damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Ighv1-52 C A 12: 115,145,492 A115S probably benign Het
Igkv6-13 A G 6: 70,457,589 S91P probably damaging Het
Ints8 T A 4: 11,204,537 E973V possibly damaging Het
Itga3 T C 11: 95,051,462 K972R probably benign Het
Klhl33 A T 14: 50,893,021 F339I probably benign Het
Krt79 T C 15: 101,937,872 M214V probably benign Het
Lgsn A T 1: 31,204,193 H452L probably benign Het
Limd2 C T 11: 106,158,690 G124D probably benign Het
Luzp1 T C 4: 136,543,444 S993P probably damaging Het
Maml2 C T 9: 13,621,185 probably benign Het
Mbtd1 A T 11: 93,924,612 H342L probably damaging Het
Mfhas1 C A 8: 35,591,356 P995Q probably damaging Het
Muc5ac T C 7: 141,818,714 F3399S possibly damaging Het
Napb T C 2: 148,700,425 Y205C probably damaging Het
Odf2 G T 2: 29,912,617 A298S probably benign Het
Olfr1082 A T 2: 86,594,144 M228K probably damaging Het
Olfr1193 A T 2: 88,678,508 I218F probably benign Het
Olfr740 A T 14: 50,453,433 Y127F probably benign Het
Pcsk5 T C 19: 17,473,112 D1124G probably benign Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pik3c2b T G 1: 133,102,372 I1457S probably benign Het
Pole2 T C 12: 69,213,906 T167A possibly damaging Het
Rfx7 T A 9: 72,618,505 S992R probably damaging Het
Ryr2 G T 13: 11,712,166 S2436R probably damaging Het
Sgo2a A G 1: 58,016,640 D661G probably damaging Het
Sh3glb2 T A 2: 30,355,321 T49S probably damaging Het
Slc16a10 T C 10: 40,056,503 K354R possibly damaging Het
Slc6a6 C A 6: 91,752,438 T568K probably benign Het
Sptbn1 T C 11: 30,100,633 T2319A probably damaging Het
Tbl1xr1 T A 3: 22,179,290 Y15N probably damaging Het
Thyn1 T C 9: 27,006,442 S160P probably damaging Het
Tshz1 A T 18: 84,015,841 D147E probably benign Het
Vmn2r50 T G 7: 10,037,757 R672S probably benign Het
Other mutations in Zfp663
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00720:Zfp663 APN 2 165352605 missense probably damaging 1.00
IGL01382:Zfp663 APN 2 165359015 missense probably damaging 1.00
IGL02007:Zfp663 APN 2 165359073 missense probably benign 0.12
IGL02164:Zfp663 APN 2 165359048 nonsense probably null
IGL02506:Zfp663 APN 2 165353951 missense probably benign 0.35
IGL03173:Zfp663 APN 2 165352499 missense probably damaging 0.99
R0735:Zfp663 UTSW 2 165359075 missense probably damaging 0.97
R1395:Zfp663 UTSW 2 165352572 missense probably damaging 1.00
R1402:Zfp663 UTSW 2 165353970 missense probably benign 0.14
R1402:Zfp663 UTSW 2 165353970 missense probably benign 0.14
R1503:Zfp663 UTSW 2 165352653 missense probably damaging 0.99
R1587:Zfp663 UTSW 2 165353517 missense probably benign
R1854:Zfp663 UTSW 2 165353291 missense probably benign 0.18
R1867:Zfp663 UTSW 2 165352731 missense possibly damaging 0.74
R3031:Zfp663 UTSW 2 165353696 nonsense probably null
R4643:Zfp663 UTSW 2 165353005 missense probably benign 0.24
R4691:Zfp663 UTSW 2 165359130 intron probably benign
R4977:Zfp663 UTSW 2 165353811 missense probably damaging 0.97
R5135:Zfp663 UTSW 2 165353670 missense possibly damaging 0.95
R5151:Zfp663 UTSW 2 165353193 missense probably benign 0.00
R5639:Zfp663 UTSW 2 165353009 missense probably benign 0.03
R5763:Zfp663 UTSW 2 165358435 nonsense probably null
R6776:Zfp663 UTSW 2 165359015 missense probably damaging 1.00
R6929:Zfp663 UTSW 2 165353258 missense probably benign
R7035:Zfp663 UTSW 2 165353103 missense probably benign 0.36
R7169:Zfp663 UTSW 2 165352439 missense probably benign 0.00
R7529:Zfp663 UTSW 2 165352808 missense probably damaging 1.00
R7790:Zfp663 UTSW 2 165352533 missense probably damaging 1.00
RF004:Zfp663 UTSW 2 165358443 missense probably benign 0.00
Z1177:Zfp663 UTSW 2 165353113 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGAGATCTTTCATCAGGCGACC -3'
(R):5'- TGCGTCAGAACCCCAGAATC -3'

Sequencing Primer
(F):5'- GACCTGGAGCCACCTAAAC -3'
(R):5'- CCTGGTCTACAAAGTGAGTTCCAG -3'
Posted On2019-05-13