Incidental Mutation 'R6998:Tbl1xr1'
ID 544329
Institutional Source Beutler Lab
Gene Symbol Tbl1xr1
Ensembl Gene ENSMUSG00000027630
Gene Name transducin (beta)-like 1X-linked receptor 1
Synonyms 8030499H02Rik, Ira1, DC42, A630076E03Rik, C21, C230089I12Rik, TBLR1
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.908) question?
Stock # R6998 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 22076652-22216594 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 22179290 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 15 (Y15N)
Ref Sequence ENSEMBL: ENSMUSP00000144436 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063988] [ENSMUST00000192328] [ENSMUST00000193734] [ENSMUST00000200793] [ENSMUST00000200943] [ENSMUST00000201509] [ENSMUST00000202356] [ENSMUST00000202747]
AlphaFold Q8BHJ5
Predicted Effect probably damaging
Transcript: ENSMUST00000063988
AA Change: Y15N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000067164
Gene: ENSMUSG00000027630
AA Change: Y15N

DomainStartEndE-ValueType
LisH 4 36 5.63e-6 SMART
low complexity region 124 138 N/A INTRINSIC
WD40 158 197 4.91e-8 SMART
WD40 208 253 9.38e-5 SMART
WD40 255 294 4.51e-7 SMART
WD40 297 335 6.89e-3 SMART
WD40 338 377 9.22e-13 SMART
WD40 380 428 1.64e-9 SMART
WD40 431 470 3.26e-13 SMART
WD40 473 511 3.85e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000192328
AA Change: Y15N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000141363
Gene: ENSMUSG00000027630
AA Change: Y15N

DomainStartEndE-ValueType
LisH 4 36 5.63e-6 SMART
low complexity region 124 138 N/A INTRINSIC
WD40 158 197 4.91e-8 SMART
WD40 208 253 9.38e-5 SMART
WD40 255 294 4.51e-7 SMART
WD40 297 335 6.89e-3 SMART
WD40 338 377 9.22e-13 SMART
WD40 380 428 1.64e-9 SMART
WD40 431 470 3.26e-13 SMART
WD40 473 511 3.85e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000193734
AA Change: Y15N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000142184
Gene: ENSMUSG00000027630
AA Change: Y15N

DomainStartEndE-ValueType
LisH 4 36 5.63e-6 SMART
low complexity region 124 138 N/A INTRINSIC
WD40 158 197 4.91e-8 SMART
WD40 208 253 9.38e-5 SMART
WD40 255 294 4.51e-7 SMART
WD40 297 335 6.89e-3 SMART
WD40 338 377 9.22e-13 SMART
WD40 380 428 1.64e-9 SMART
WD40 431 470 3.26e-13 SMART
WD40 473 511 3.85e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000200793
AA Change: Y15N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144138
Gene: ENSMUSG00000027630
AA Change: Y15N

DomainStartEndE-ValueType
LisH 4 36 1.7e-8 SMART
low complexity region 124 138 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200943
AA Change: Y15N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144602
Gene: ENSMUSG00000027630
AA Change: Y15N

DomainStartEndE-ValueType
LisH 4 36 1.7e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000201509
AA Change: Y15N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144547
Gene: ENSMUSG00000027630
AA Change: Y15N

DomainStartEndE-ValueType
LisH 4 36 1.7e-8 SMART
low complexity region 124 138 N/A INTRINSIC
WD40 158 197 3.2e-10 SMART
WD40 208 253 6.2e-7 SMART
WD40 255 294 2.9e-9 SMART
WD40 297 335 4.5e-5 SMART
WD40 338 377 5.9e-15 SMART
WD40 380 428 1.1e-11 SMART
WD40 431 470 2.1e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202356
AA Change: Y15N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144301
Gene: ENSMUSG00000027630
AA Change: Y15N

DomainStartEndE-ValueType
LisH 4 36 1.7e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202747
AA Change: Y15N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144436
Gene: ENSMUSG00000027630
AA Change: Y15N

DomainStartEndE-ValueType
LisH 4 36 5.63e-6 SMART
low complexity region 124 138 N/A INTRINSIC
WD40 158 197 4.91e-8 SMART
WD40 208 253 9.38e-5 SMART
WD40 255 294 4.51e-7 SMART
WD40 297 335 6.89e-3 SMART
WD40 338 377 9.22e-13 SMART
WD40 380 428 1.64e-9 SMART
WD40 431 470 3.26e-13 SMART
WD40 473 511 3.85e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the WD40 repeat-containing gene family and shares sequence similarity with transducin (beta)-like 1X-linked (TBL1X). The protein encoded by this gene is thought to be a component of both nuclear receptor corepressor (N-CoR) and histone deacetylase 3 (HDAC 3) complexes, and is required for transcriptional activation by a variety of transcription factors. Mutations in these gene have been associated with some autism spectrum disorders, and one finding suggests that haploinsufficiency of this gene may be a cause of intellectual disability with dysmorphism. Mutations in this gene as well as recurrent translocations involving this gene have also been observed in some tumors. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a conditional allele activated in adipose tissue exhibit increased body weight, and total body fat and increased susceptibility to diet-induced obesity and impaired glucose homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam30 A G 3: 98,162,710 R620G probably benign Het
Adcy1 A C 11: 7,079,026 N259H probably damaging Het
Ahctf1 G A 1: 179,770,915 R2* probably null Het
Akr1c21 A G 13: 4,583,851 I306M probably benign Het
Alg9 T A 9: 50,789,621 S230R possibly damaging Het
Armt1 T A 10: 4,453,937 C341S probably benign Het
Aspg T A 12: 112,112,194 L29M probably damaging Het
Aspm C T 1: 139,469,472 T934I probably damaging Het
C1rl T C 6: 124,508,902 S411P probably damaging Het
Card14 A G 11: 119,322,899 E224G probably damaging Het
Ccdc88c T C 12: 100,916,852 H1587R probably damaging Het
Ccp110 A G 7: 118,732,897 T963A possibly damaging Het
Cdk11b G A 4: 155,648,343 W546* probably null Het
Cyp8b1 T C 9: 121,915,993 N91S probably benign Het
Dab2 G T 15: 6,424,649 M213I possibly damaging Het
Decr1 A G 4: 15,930,960 V124A probably damaging Het
Fbxl13 T A 5: 21,543,689 I411F probably damaging Het
Fbxl13 T C 5: 21,620,613 I164V probably null Het
Fndc7 G A 3: 108,876,648 A215V probably benign Het
Garem2 T C 5: 30,114,170 M210T possibly damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Ighv1-52 C A 12: 115,145,492 A115S probably benign Het
Igkv6-13 A G 6: 70,457,589 S91P probably damaging Het
Ints8 T A 4: 11,204,537 E973V possibly damaging Het
Itga3 T C 11: 95,051,462 K972R probably benign Het
Klhl33 A T 14: 50,893,021 F339I probably benign Het
Krt79 T C 15: 101,937,872 M214V probably benign Het
Lgsn A T 1: 31,204,193 H452L probably benign Het
Limd2 C T 11: 106,158,690 G124D probably benign Het
Luzp1 T C 4: 136,543,444 S993P probably damaging Het
Maml2 C T 9: 13,621,185 probably benign Het
Mbtd1 A T 11: 93,924,612 H342L probably damaging Het
Mfhas1 C A 8: 35,591,356 P995Q probably damaging Het
Muc5ac T C 7: 141,818,714 F3399S possibly damaging Het
Napb T C 2: 148,700,425 Y205C probably damaging Het
Odf2 G T 2: 29,912,617 A298S probably benign Het
Olfr1082 A T 2: 86,594,144 M228K probably damaging Het
Olfr1193 A T 2: 88,678,508 I218F probably benign Het
Olfr740 A T 14: 50,453,433 Y127F probably benign Het
Pcsk5 T C 19: 17,473,112 D1124G probably benign Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pik3c2b T G 1: 133,102,372 I1457S probably benign Het
Pole2 T C 12: 69,213,906 T167A possibly damaging Het
Rfx7 T A 9: 72,618,505 S992R probably damaging Het
Ryr2 G T 13: 11,712,166 S2436R probably damaging Het
Sgo2a A G 1: 58,016,640 D661G probably damaging Het
Sh3glb2 T A 2: 30,355,321 T49S probably damaging Het
Slc16a10 T C 10: 40,056,503 K354R possibly damaging Het
Slc6a6 C A 6: 91,752,438 T568K probably benign Het
Sptbn1 T C 11: 30,100,633 T2319A probably damaging Het
Thyn1 T C 9: 27,006,442 S160P probably damaging Het
Tshz1 A T 18: 84,015,841 D147E probably benign Het
Vmn2r50 T G 7: 10,037,757 R672S probably benign Het
Zfp663 A T 2: 165,354,002 I99N possibly damaging Het
Other mutations in Tbl1xr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Tbl1xr1 APN 3 22192268 critical splice donor site probably null
IGL00825:Tbl1xr1 APN 3 22189786 splice site probably null
IGL01622:Tbl1xr1 APN 3 22192074 missense probably benign 0.01
IGL01623:Tbl1xr1 APN 3 22192074 missense probably benign 0.01
IGL01717:Tbl1xr1 APN 3 22193171 splice site probably benign
IGL02421:Tbl1xr1 APN 3 22203163 missense probably damaging 0.99
IGL03117:Tbl1xr1 APN 3 22203159 nonsense probably null
R0076:Tbl1xr1 UTSW 3 22189785 missense probably benign 0.06
R0601:Tbl1xr1 UTSW 3 22179319 splice site probably benign
R0629:Tbl1xr1 UTSW 3 22210401 missense probably benign 0.41
R0654:Tbl1xr1 UTSW 3 22203994 critical splice donor site probably null
R0811:Tbl1xr1 UTSW 3 22200587 splice site probably benign
R1457:Tbl1xr1 UTSW 3 22193169 critical splice donor site probably null
R1496:Tbl1xr1 UTSW 3 22190951 missense possibly damaging 0.68
R1914:Tbl1xr1 UTSW 3 22190910 splice site probably benign
R2680:Tbl1xr1 UTSW 3 22191451 missense possibly damaging 0.76
R3929:Tbl1xr1 UTSW 3 22189768 missense probably damaging 1.00
R4193:Tbl1xr1 UTSW 3 22200358 missense possibly damaging 0.90
R4440:Tbl1xr1 UTSW 3 22200588 critical splice acceptor site probably null
R4642:Tbl1xr1 UTSW 3 22188420 missense probably damaging 1.00
R5187:Tbl1xr1 UTSW 3 22209606 missense probably damaging 1.00
R5361:Tbl1xr1 UTSW 3 22192069 missense probably damaging 0.97
R5430:Tbl1xr1 UTSW 3 22192082 missense probably benign 0.01
R5710:Tbl1xr1 UTSW 3 22210414 missense probably damaging 0.99
R6490:Tbl1xr1 UTSW 3 22203977 missense probably damaging 0.97
R6512:Tbl1xr1 UTSW 3 22140534 intron probably benign
R6778:Tbl1xr1 UTSW 3 22189782 missense probably benign 0.00
R6861:Tbl1xr1 UTSW 3 22191439 missense possibly damaging 0.68
R6861:Tbl1xr1 UTSW 3 22191539 splice site probably null
R6878:Tbl1xr1 UTSW 3 22203204 missense possibly damaging 0.90
R7409:Tbl1xr1 UTSW 3 22203190 missense possibly damaging 0.56
R8029:Tbl1xr1 UTSW 3 22200436 missense probably damaging 0.98
R8670:Tbl1xr1 UTSW 3 22191000 missense probably damaging 1.00
R9251:Tbl1xr1 UTSW 3 22210405 missense probably benign 0.21
R9339:Tbl1xr1 UTSW 3 22203986 missense possibly damaging 0.72
X0011:Tbl1xr1 UTSW 3 22203092 splice site probably null
Predicted Primers PCR Primer
(F):5'- GCTGCAAAGCAATAAGAACCTTTG -3'
(R):5'- ATTTGCCTGAGATGATCCCAAC -3'

Sequencing Primer
(F):5'- GTATTCTTGTACTGAGAAAA -3'
(R):5'- GCCTGAGATGATCCCAACATATTTG -3'
Posted On 2019-05-13