Incidental Mutation 'R6998:Fndc7'
ID 544331
Institutional Source Beutler Lab
Gene Symbol Fndc7
Ensembl Gene ENSMUSG00000045326
Gene Name fibronectin type III domain containing 7
Synonyms E230011A21Rik
MMRRC Submission 045010-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6998 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 108760994-108797324 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 108783964 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 215 (A215V)
Ref Sequence ENSEMBL: ENSMUSP00000136215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053065] [ENSMUST00000102620] [ENSMUST00000180063]
AlphaFold A2AED3
Predicted Effect probably benign
Transcript: ENSMUST00000053065
SMART Domains Protein: ENSMUSP00000051172
Gene: ENSMUSG00000045326

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
FN3 29 102 2.62e-5 SMART
FN3 113 189 1.31e-5 SMART
Blast:FN3 201 274 9e-44 BLAST
FN3 283 360 1.07e-1 SMART
FN3 457 530 5.1e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102620
AA Change: A215V

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000099680
Gene: ENSMUSG00000045326
AA Change: A215V

DomainStartEndE-ValueType
FN3 29 102 2.62e-5 SMART
FN3 113 189 1.31e-5 SMART
FN3 201 275 2.44e-5 SMART
Blast:FN3 287 360 1e-43 BLAST
FN3 369 446 1.07e-1 SMART
FN3 543 616 5.1e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000180063
AA Change: A215V

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000136215
Gene: ENSMUSG00000045326
AA Change: A215V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
FN3 29 102 2.62e-5 SMART
FN3 113 189 1.31e-5 SMART
FN3 201 275 2.44e-5 SMART
Blast:FN3 287 360 2e-43 BLAST
FN3 369 446 1.07e-1 SMART
FN3 543 616 5.1e1 SMART
Meta Mutation Damage Score 0.1460 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam30 A G 3: 98,070,026 (GRCm39) R620G probably benign Het
Adcy1 A C 11: 7,029,026 (GRCm39) N259H probably damaging Het
Ahctf1 G A 1: 179,598,480 (GRCm39) R2* probably null Het
Akr1c21 A G 13: 4,633,850 (GRCm39) I306M probably benign Het
Alg9 T A 9: 50,700,921 (GRCm39) S230R possibly damaging Het
Armt1 T A 10: 4,403,937 (GRCm39) C341S probably benign Het
Aspg T A 12: 112,078,628 (GRCm39) L29M probably damaging Het
Aspm C T 1: 139,397,210 (GRCm39) T934I probably damaging Het
C1rl T C 6: 124,485,861 (GRCm39) S411P probably damaging Het
Card14 A G 11: 119,213,725 (GRCm39) E224G probably damaging Het
Ccdc88c T C 12: 100,883,111 (GRCm39) H1587R probably damaging Het
Ccp110 A G 7: 118,332,120 (GRCm39) T963A possibly damaging Het
Cdk11b G A 4: 155,732,800 (GRCm39) W546* probably null Het
Cyp8b1 T C 9: 121,745,059 (GRCm39) N91S probably benign Het
Dab2 G T 15: 6,454,130 (GRCm39) M213I possibly damaging Het
Decr1 A G 4: 15,930,960 (GRCm39) V124A probably damaging Het
Fbxl13 T A 5: 21,748,687 (GRCm39) I411F probably damaging Het
Fbxl13 T C 5: 21,825,611 (GRCm39) I164V probably null Het
Garem2 T C 5: 30,319,168 (GRCm39) M210T possibly damaging Het
Gpatch2l G A 12: 86,290,958 (GRCm39) R47H probably damaging Het
Ighv1-52 C A 12: 115,109,112 (GRCm39) A115S probably benign Het
Igkv6-13 A G 6: 70,434,573 (GRCm39) S91P probably damaging Het
Ints8 T A 4: 11,204,537 (GRCm39) E973V possibly damaging Het
Itga3 T C 11: 94,942,288 (GRCm39) K972R probably benign Het
Klhl33 A T 14: 51,130,478 (GRCm39) F339I probably benign Het
Krt79 T C 15: 101,846,307 (GRCm39) M214V probably benign Het
Lgsn A T 1: 31,243,274 (GRCm39) H452L probably benign Het
Limd2 C T 11: 106,049,516 (GRCm39) G124D probably benign Het
Luzp1 T C 4: 136,270,755 (GRCm39) S993P probably damaging Het
Maml2 C T 9: 13,532,481 (GRCm39) probably benign Het
Mbtd1 A T 11: 93,815,438 (GRCm39) H342L probably damaging Het
Mfhas1 C A 8: 36,058,510 (GRCm39) P995Q probably damaging Het
Muc5ac T C 7: 141,372,451 (GRCm39) F3399S possibly damaging Het
Napb T C 2: 148,542,345 (GRCm39) Y205C probably damaging Het
Odf2 G T 2: 29,802,629 (GRCm39) A298S probably benign Het
Or11g7 A T 14: 50,690,890 (GRCm39) Y127F probably benign Het
Or4s2b A T 2: 88,508,852 (GRCm39) I218F probably benign Het
Or8k35 A T 2: 86,424,488 (GRCm39) M228K probably damaging Het
Pcsk5 T C 19: 17,450,476 (GRCm39) D1124G probably benign Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 (GRCm39) probably benign Het
Pik3c2b T G 1: 133,030,110 (GRCm39) I1457S probably benign Het
Pole2 T C 12: 69,260,680 (GRCm39) T167A possibly damaging Het
Rfx7 T A 9: 72,525,787 (GRCm39) S992R probably damaging Het
Ryr2 G T 13: 11,727,052 (GRCm39) S2436R probably damaging Het
Sgo2a A G 1: 58,055,799 (GRCm39) D661G probably damaging Het
Sh3glb2 T A 2: 30,245,333 (GRCm39) T49S probably damaging Het
Slc16a10 T C 10: 39,932,499 (GRCm39) K354R possibly damaging Het
Slc6a6 C A 6: 91,729,419 (GRCm39) T568K probably benign Het
Sptbn1 T C 11: 30,050,633 (GRCm39) T2319A probably damaging Het
Tbl1xr1 T A 3: 22,233,454 (GRCm39) Y15N probably damaging Het
Thyn1 T C 9: 26,917,738 (GRCm39) S160P probably damaging Het
Tshz1 A T 18: 84,033,966 (GRCm39) D147E probably benign Het
Vmn2r50 T G 7: 9,771,684 (GRCm39) R672S probably benign Het
Zfp663 A T 2: 165,195,922 (GRCm39) I99N possibly damaging Het
Other mutations in Fndc7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02077:Fndc7 APN 3 108,790,784 (GRCm39) missense probably benign 0.17
IGL02823:Fndc7 APN 3 108,776,487 (GRCm39) missense probably damaging 1.00
IGL02896:Fndc7 APN 3 108,770,247 (GRCm39) missense probably benign 0.04
IGL03196:Fndc7 APN 3 108,790,760 (GRCm39) missense probably damaging 1.00
IGL03343:Fndc7 APN 3 108,774,624 (GRCm39) missense probably damaging 1.00
IGL03377:Fndc7 APN 3 108,783,848 (GRCm39) missense probably benign 0.12
R0240:Fndc7 UTSW 3 108,766,235 (GRCm39) splice site probably benign
R0324:Fndc7 UTSW 3 108,784,015 (GRCm39) splice site probably null
R0457:Fndc7 UTSW 3 108,783,861 (GRCm39) missense probably benign 0.02
R0630:Fndc7 UTSW 3 108,783,931 (GRCm39) missense probably damaging 1.00
R0891:Fndc7 UTSW 3 108,777,904 (GRCm39) missense possibly damaging 0.54
R1752:Fndc7 UTSW 3 108,776,646 (GRCm39) missense probably benign 0.14
R1772:Fndc7 UTSW 3 108,777,850 (GRCm39) missense probably damaging 1.00
R1923:Fndc7 UTSW 3 108,784,003 (GRCm39) missense probably benign 0.00
R1957:Fndc7 UTSW 3 108,790,825 (GRCm39) missense probably damaging 0.98
R3801:Fndc7 UTSW 3 108,776,464 (GRCm39) missense possibly damaging 0.95
R4592:Fndc7 UTSW 3 108,766,218 (GRCm39) missense probably damaging 1.00
R4650:Fndc7 UTSW 3 108,770,135 (GRCm39) missense probably benign 0.15
R4652:Fndc7 UTSW 3 108,770,135 (GRCm39) missense probably benign 0.15
R4791:Fndc7 UTSW 3 108,783,975 (GRCm39) missense probably benign 0.00
R4933:Fndc7 UTSW 3 108,783,986 (GRCm39) missense probably benign 0.01
R5004:Fndc7 UTSW 3 108,790,789 (GRCm39) missense probably damaging 1.00
R5042:Fndc7 UTSW 3 108,770,102 (GRCm39) missense probably damaging 1.00
R5054:Fndc7 UTSW 3 108,788,663 (GRCm39) missense probably damaging 0.97
R5175:Fndc7 UTSW 3 108,776,482 (GRCm39) missense probably benign 0.04
R5325:Fndc7 UTSW 3 108,790,765 (GRCm39) missense probably damaging 1.00
R5571:Fndc7 UTSW 3 108,763,724 (GRCm39) missense possibly damaging 0.68
R5638:Fndc7 UTSW 3 108,770,208 (GRCm39) missense possibly damaging 0.69
R5846:Fndc7 UTSW 3 108,788,707 (GRCm39) missense probably damaging 1.00
R6488:Fndc7 UTSW 3 108,777,891 (GRCm39) missense probably damaging 0.99
R6737:Fndc7 UTSW 3 108,779,594 (GRCm39) missense probably damaging 1.00
R6993:Fndc7 UTSW 3 108,783,907 (GRCm39) missense probably benign 0.00
R6999:Fndc7 UTSW 3 108,783,964 (GRCm39) missense probably benign 0.02
R7000:Fndc7 UTSW 3 108,783,964 (GRCm39) missense probably benign 0.02
R7001:Fndc7 UTSW 3 108,783,964 (GRCm39) missense probably benign 0.02
R7181:Fndc7 UTSW 3 108,788,640 (GRCm39) critical splice donor site probably null
R7324:Fndc7 UTSW 3 108,779,537 (GRCm39) missense probably benign 0.06
R7425:Fndc7 UTSW 3 108,783,975 (GRCm39) missense probably benign 0.00
R7631:Fndc7 UTSW 3 108,776,568 (GRCm39) missense probably damaging 1.00
R7702:Fndc7 UTSW 3 108,770,129 (GRCm39) missense probably damaging 0.98
R7713:Fndc7 UTSW 3 108,777,979 (GRCm39) missense possibly damaging 0.90
R7909:Fndc7 UTSW 3 108,770,232 (GRCm39) missense probably benign 0.04
R7946:Fndc7 UTSW 3 108,779,452 (GRCm39) missense possibly damaging 0.78
R8023:Fndc7 UTSW 3 108,774,461 (GRCm39) missense probably damaging 1.00
R8694:Fndc7 UTSW 3 108,779,622 (GRCm39) nonsense probably null
R8708:Fndc7 UTSW 3 108,774,528 (GRCm39) missense probably benign 0.00
R9325:Fndc7 UTSW 3 108,790,834 (GRCm39) missense possibly damaging 0.55
R9608:Fndc7 UTSW 3 108,774,597 (GRCm39) missense probably damaging 1.00
Z1088:Fndc7 UTSW 3 108,790,816 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGTGCAGAGCAGGACTTG -3'
(R):5'- ATGGCCATGAGGTTATCAATCCC -3'

Sequencing Primer
(F):5'- AGGACTTGCTGGACCCAG -3'
(R):5'- ATGAGGTTATCAATCCCCAGAC -3'
Posted On 2019-05-13