Incidental Mutation 'R6998:Cdk11b'
ID 544335
Institutional Source Beutler Lab
Gene Symbol Cdk11b
Ensembl Gene ENSMUSG00000029062
Gene Name cyclin dependent kinase 11B
Synonyms Cdc2l2, PITSLRE proteins, Cdc2l1, CDK11-p110, CDK11-p46, CDK11-p58
MMRRC Submission 045010-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6998 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 155709311-155734395 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 155732800 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Stop codon at position 546 (W546*)
Ref Sequence ENSEMBL: ENSMUSP00000101225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030937] [ENSMUST00000067081] [ENSMUST00000105598] [ENSMUST00000105600] [ENSMUST00000115821]
AlphaFold P24788
Predicted Effect probably benign
Transcript: ENSMUST00000030937
SMART Domains Protein: ENSMUSP00000030937
Gene: ENSMUSG00000029061

DomainStartEndE-ValueType
low complexity region 19 41 N/A INTRINSIC
ZnMc 85 256 8.39e-48 SMART
ShKT 255 291 4.06e-10 SMART
IG 307 390 4.53e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000067081
AA Change: W546*
SMART Domains Protein: ENSMUSP00000070527
Gene: ENSMUSG00000029062
AA Change: W546*

DomainStartEndE-ValueType
low complexity region 19 48 N/A INTRINSIC
low complexity region 93 112 N/A INTRINSIC
coiled coil region 123 214 N/A INTRINSIC
low complexity region 252 259 N/A INTRINSIC
low complexity region 261 272 N/A INTRINSIC
coiled coil region 290 337 N/A INTRINSIC
low complexity region 369 383 N/A INTRINSIC
S_TKc 427 712 5.05e-93 SMART
Predicted Effect probably null
Transcript: ENSMUST00000105598
AA Change: W512*
SMART Domains Protein: ENSMUSP00000101223
Gene: ENSMUSG00000029062
AA Change: W512*

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 59 78 N/A INTRINSIC
coiled coil region 89 180 N/A INTRINSIC
low complexity region 218 225 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
coiled coil region 256 303 N/A INTRINSIC
low complexity region 335 349 N/A INTRINSIC
S_TKc 393 678 5.05e-93 SMART
Predicted Effect probably null
Transcript: ENSMUST00000105600
AA Change: W546*
SMART Domains Protein: ENSMUSP00000101225
Gene: ENSMUSG00000029062
AA Change: W546*

DomainStartEndE-ValueType
low complexity region 19 48 N/A INTRINSIC
low complexity region 93 112 N/A INTRINSIC
coiled coil region 123 214 N/A INTRINSIC
low complexity region 252 259 N/A INTRINSIC
low complexity region 261 272 N/A INTRINSIC
coiled coil region 290 337 N/A INTRINSIC
low complexity region 369 383 N/A INTRINSIC
S_TKc 427 712 5.05e-93 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115821
SMART Domains Protein: ENSMUSP00000111488
Gene: ENSMUSG00000073682

DomainStartEndE-ValueType
SCOP:d1l9ha_ 17 52 2e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine protein kinase family. Members of this kinase family are known to be essential for eukaryotic cell cycle control. Due to a segmental duplication, this gene shares very high sequence identity with a neighboring gene. These two genes are frequently deleted or altered in neuroblastoma. The protein kinase encoded by this gene can be cleaved by caspases and may play a role in cell apoptosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null embryos display embryonic lethality from cell cycle arrest. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam30 A G 3: 98,070,026 (GRCm39) R620G probably benign Het
Adcy1 A C 11: 7,029,026 (GRCm39) N259H probably damaging Het
Ahctf1 G A 1: 179,598,480 (GRCm39) R2* probably null Het
Akr1c21 A G 13: 4,633,850 (GRCm39) I306M probably benign Het
Alg9 T A 9: 50,700,921 (GRCm39) S230R possibly damaging Het
Armt1 T A 10: 4,403,937 (GRCm39) C341S probably benign Het
Aspg T A 12: 112,078,628 (GRCm39) L29M probably damaging Het
Aspm C T 1: 139,397,210 (GRCm39) T934I probably damaging Het
C1rl T C 6: 124,485,861 (GRCm39) S411P probably damaging Het
Card14 A G 11: 119,213,725 (GRCm39) E224G probably damaging Het
Ccdc88c T C 12: 100,883,111 (GRCm39) H1587R probably damaging Het
Ccp110 A G 7: 118,332,120 (GRCm39) T963A possibly damaging Het
Cyp8b1 T C 9: 121,745,059 (GRCm39) N91S probably benign Het
Dab2 G T 15: 6,454,130 (GRCm39) M213I possibly damaging Het
Decr1 A G 4: 15,930,960 (GRCm39) V124A probably damaging Het
Fbxl13 T A 5: 21,748,687 (GRCm39) I411F probably damaging Het
Fbxl13 T C 5: 21,825,611 (GRCm39) I164V probably null Het
Fndc7 G A 3: 108,783,964 (GRCm39) A215V probably benign Het
Garem2 T C 5: 30,319,168 (GRCm39) M210T possibly damaging Het
Gpatch2l G A 12: 86,290,958 (GRCm39) R47H probably damaging Het
Ighv1-52 C A 12: 115,109,112 (GRCm39) A115S probably benign Het
Igkv6-13 A G 6: 70,434,573 (GRCm39) S91P probably damaging Het
Ints8 T A 4: 11,204,537 (GRCm39) E973V possibly damaging Het
Itga3 T C 11: 94,942,288 (GRCm39) K972R probably benign Het
Klhl33 A T 14: 51,130,478 (GRCm39) F339I probably benign Het
Krt79 T C 15: 101,846,307 (GRCm39) M214V probably benign Het
Lgsn A T 1: 31,243,274 (GRCm39) H452L probably benign Het
Limd2 C T 11: 106,049,516 (GRCm39) G124D probably benign Het
Luzp1 T C 4: 136,270,755 (GRCm39) S993P probably damaging Het
Maml2 C T 9: 13,532,481 (GRCm39) probably benign Het
Mbtd1 A T 11: 93,815,438 (GRCm39) H342L probably damaging Het
Mfhas1 C A 8: 36,058,510 (GRCm39) P995Q probably damaging Het
Muc5ac T C 7: 141,372,451 (GRCm39) F3399S possibly damaging Het
Napb T C 2: 148,542,345 (GRCm39) Y205C probably damaging Het
Odf2 G T 2: 29,802,629 (GRCm39) A298S probably benign Het
Or11g7 A T 14: 50,690,890 (GRCm39) Y127F probably benign Het
Or4s2b A T 2: 88,508,852 (GRCm39) I218F probably benign Het
Or8k35 A T 2: 86,424,488 (GRCm39) M228K probably damaging Het
Pcsk5 T C 19: 17,450,476 (GRCm39) D1124G probably benign Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 (GRCm39) probably benign Het
Pik3c2b T G 1: 133,030,110 (GRCm39) I1457S probably benign Het
Pole2 T C 12: 69,260,680 (GRCm39) T167A possibly damaging Het
Rfx7 T A 9: 72,525,787 (GRCm39) S992R probably damaging Het
Ryr2 G T 13: 11,727,052 (GRCm39) S2436R probably damaging Het
Sgo2a A G 1: 58,055,799 (GRCm39) D661G probably damaging Het
Sh3glb2 T A 2: 30,245,333 (GRCm39) T49S probably damaging Het
Slc16a10 T C 10: 39,932,499 (GRCm39) K354R possibly damaging Het
Slc6a6 C A 6: 91,729,419 (GRCm39) T568K probably benign Het
Sptbn1 T C 11: 30,050,633 (GRCm39) T2319A probably damaging Het
Tbl1xr1 T A 3: 22,233,454 (GRCm39) Y15N probably damaging Het
Thyn1 T C 9: 26,917,738 (GRCm39) S160P probably damaging Het
Tshz1 A T 18: 84,033,966 (GRCm39) D147E probably benign Het
Vmn2r50 T G 7: 9,771,684 (GRCm39) R672S probably benign Het
Zfp663 A T 2: 165,195,922 (GRCm39) I99N possibly damaging Het
Other mutations in Cdk11b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01764:Cdk11b APN 4 155,713,260 (GRCm39) missense possibly damaging 0.54
R0071:Cdk11b UTSW 4 155,733,880 (GRCm39) unclassified probably benign
R0071:Cdk11b UTSW 4 155,733,880 (GRCm39) unclassified probably benign
R0145:Cdk11b UTSW 4 155,726,076 (GRCm39) intron probably benign
R0372:Cdk11b UTSW 4 155,725,957 (GRCm39) intron probably benign
R0426:Cdk11b UTSW 4 155,726,969 (GRCm39) intron probably benign
R0471:Cdk11b UTSW 4 155,731,999 (GRCm39) unclassified probably benign
R0627:Cdk11b UTSW 4 155,725,229 (GRCm39) intron probably benign
R1475:Cdk11b UTSW 4 155,718,674 (GRCm39) missense probably damaging 1.00
R1611:Cdk11b UTSW 4 155,726,032 (GRCm39) intron probably benign
R1719:Cdk11b UTSW 4 155,732,854 (GRCm39) unclassified probably benign
R1750:Cdk11b UTSW 4 155,713,137 (GRCm39) splice site probably null
R2061:Cdk11b UTSW 4 155,726,061 (GRCm39) intron probably benign
R2274:Cdk11b UTSW 4 155,732,051 (GRCm39) unclassified probably benign
R2922:Cdk11b UTSW 4 155,725,201 (GRCm39) intron probably benign
R3719:Cdk11b UTSW 4 155,711,343 (GRCm39) missense probably damaging 1.00
R3917:Cdk11b UTSW 4 155,711,258 (GRCm39) missense probably damaging 1.00
R4077:Cdk11b UTSW 4 155,724,204 (GRCm39) intron probably benign
R4078:Cdk11b UTSW 4 155,724,204 (GRCm39) intron probably benign
R5033:Cdk11b UTSW 4 155,733,282 (GRCm39) unclassified probably benign
R5212:Cdk11b UTSW 4 155,723,072 (GRCm39) splice site probably null
R5556:Cdk11b UTSW 4 155,718,604 (GRCm39) nonsense probably null
R5622:Cdk11b UTSW 4 155,714,674 (GRCm39) missense probably damaging 1.00
R5927:Cdk11b UTSW 4 155,732,697 (GRCm39) unclassified probably benign
R5975:Cdk11b UTSW 4 155,732,697 (GRCm39) unclassified probably benign
R6276:Cdk11b UTSW 4 155,718,647 (GRCm39) missense probably benign 0.11
R6278:Cdk11b UTSW 4 155,734,060 (GRCm39) unclassified probably benign
R6905:Cdk11b UTSW 4 155,726,065 (GRCm39) intron probably benign
R7021:Cdk11b UTSW 4 155,726,024 (GRCm39) intron probably benign
R7062:Cdk11b UTSW 4 155,711,268 (GRCm39) missense probably damaging 1.00
R7100:Cdk11b UTSW 4 155,710,050 (GRCm39) missense probably damaging 1.00
R7338:Cdk11b UTSW 4 155,732,008 (GRCm39) missense unknown
R7811:Cdk11b UTSW 4 155,724,359 (GRCm39) missense unknown
R8213:Cdk11b UTSW 4 155,724,338 (GRCm39) missense unknown
R8257:Cdk11b UTSW 4 155,732,398 (GRCm39) missense unknown
R8696:Cdk11b UTSW 4 155,732,779 (GRCm39) missense unknown
R9419:Cdk11b UTSW 4 155,724,302 (GRCm39) missense unknown
R9546:Cdk11b UTSW 4 155,733,589 (GRCm39) missense unknown
R9628:Cdk11b UTSW 4 155,734,154 (GRCm39) missense unknown
R9792:Cdk11b UTSW 4 155,732,378 (GRCm39) missense unknown
R9793:Cdk11b UTSW 4 155,732,378 (GRCm39) missense unknown
Z1088:Cdk11b UTSW 4 155,726,021 (GRCm39) intron probably benign
Predicted Primers PCR Primer
(F):5'- TTGCCCCAGAAGTCTAGTTGC -3'
(R):5'- CACAGGGTTACAACAACTGGAG -3'

Sequencing Primer
(F):5'- CCCAGAAGTCTAGTTGCTGCTG -3'
(R):5'- GCCTTTAGGGGTGAACCATACTC -3'
Posted On 2019-05-13