Incidental Mutation 'R6998:Peg10'
ID 544339
Institutional Source Beutler Lab
Gene Symbol Peg10
Ensembl Gene ENSMUSG00000092035
Gene Name paternally expressed 10
Synonyms MEF3L, MyEF-3 like, Rtl2, Mar2, MyEF-3, HB-1, Edr, Mart2
MMRRC Submission 045010-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6998 (G1)
Quality Score 193.468
Status Not validated
Chromosome 6
Chromosomal Location 4747306-4760517 bp(+) (GRCm39)
Type of Mutation small deletion (18 aa in frame mutation)
DNA Base Change (assembly) CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG to CCACATCAGGATCCACATCAGGATGCACATCAG at 4756398 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166678] [ENSMUST00000176204] [ENSMUST00000176551]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000166678
SMART Domains Protein: ENSMUSP00000127306
Gene: ENSMUSG00000092035

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
low complexity region 34 50 N/A INTRINSIC
low complexity region 80 107 N/A INTRINSIC
Pfam:DUF4939 130 220 6.1e-17 PFAM
Pfam:Retrotrans_gag 174 267 2.9e-20 PFAM
low complexity region 334 342 N/A INTRINSIC
ZnF_C2HC 345 361 3.34e-2 SMART
low complexity region 368 379 N/A INTRINSIC
low complexity region 541 610 N/A INTRINSIC
low complexity region 621 660 N/A INTRINSIC
low complexity region 663 785 N/A INTRINSIC
Blast:SERPIN 798 910 1e-5 BLAST
low complexity region 923 936 N/A INTRINSIC
low complexity region 972 998 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176204
SMART Domains Protein: ENSMUSP00000134963
Gene: ENSMUSG00000092035

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
low complexity region 34 50 N/A INTRINSIC
low complexity region 80 107 N/A INTRINSIC
Pfam:Retrotrans_gag 174 267 1.3e-20 PFAM
low complexity region 334 342 N/A INTRINSIC
ZnF_C2HC 345 361 3.34e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176551
SMART Domains Protein: ENSMUSP00000135076
Gene: ENSMUSG00000092035

DomainStartEndE-ValueType
low complexity region 173 242 N/A INTRINSIC
low complexity region 253 292 N/A INTRINSIC
low complexity region 295 417 N/A INTRINSIC
Blast:SERPIN 430 542 6e-6 BLAST
low complexity region 555 568 N/A INTRINSIC
low complexity region 604 630 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This is a paternally expressed imprinted gene that is thought to have been derived from the Ty3/Gypsy family of retrotransposons. It contains two overlapping open reading frames, RF1 and RF2, and expresses two proteins: a shorter, gag-like protein (with a CCHC-type zinc finger domain) from RF1; and a longer, gag/pol-like fusion protein (with an additional aspartic protease motif) from RF1/RF2 by -1 translational frameshifting (-1 FS). While -1 FS has been observed in RNA viruses and transposons in both prokaryotes and eukaryotes, this gene represents the first example of -1 FS in a eukaryotic cellular gene. This gene is highly conserved across mammalian species and retains the heptanucleotide (GGGAAAC) and pseudoknot elements required for -1 FS. It is expressed in adult and embryonic tissues (most notably in placenta) and reported to have a role in cell proliferation, differentiation, apoptosis and cancer development. Knockout mice lacking this gene showed early embryonic lethality with placental defects, indicating the importance of this gene in embryonic development. [provided by RefSeq, Oct 2014]
PHENOTYPE: Heterozygous mice with a paternally inherited null allele display embryonic lethality during organogenesis with abnormal placental development. Heterozygous mice with a maternally inherited null allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam30 A G 3: 98,070,026 (GRCm39) R620G probably benign Het
Adcy1 A C 11: 7,029,026 (GRCm39) N259H probably damaging Het
Ahctf1 G A 1: 179,598,480 (GRCm39) R2* probably null Het
Akr1c21 A G 13: 4,633,850 (GRCm39) I306M probably benign Het
Alg9 T A 9: 50,700,921 (GRCm39) S230R possibly damaging Het
Armt1 T A 10: 4,403,937 (GRCm39) C341S probably benign Het
Aspg T A 12: 112,078,628 (GRCm39) L29M probably damaging Het
Aspm C T 1: 139,397,210 (GRCm39) T934I probably damaging Het
C1rl T C 6: 124,485,861 (GRCm39) S411P probably damaging Het
Card14 A G 11: 119,213,725 (GRCm39) E224G probably damaging Het
Ccdc88c T C 12: 100,883,111 (GRCm39) H1587R probably damaging Het
Ccp110 A G 7: 118,332,120 (GRCm39) T963A possibly damaging Het
Cdk11b G A 4: 155,732,800 (GRCm39) W546* probably null Het
Cyp8b1 T C 9: 121,745,059 (GRCm39) N91S probably benign Het
Dab2 G T 15: 6,454,130 (GRCm39) M213I possibly damaging Het
Decr1 A G 4: 15,930,960 (GRCm39) V124A probably damaging Het
Fbxl13 T A 5: 21,748,687 (GRCm39) I411F probably damaging Het
Fbxl13 T C 5: 21,825,611 (GRCm39) I164V probably null Het
Fndc7 G A 3: 108,783,964 (GRCm39) A215V probably benign Het
Garem2 T C 5: 30,319,168 (GRCm39) M210T possibly damaging Het
Gpatch2l G A 12: 86,290,958 (GRCm39) R47H probably damaging Het
Ighv1-52 C A 12: 115,109,112 (GRCm39) A115S probably benign Het
Igkv6-13 A G 6: 70,434,573 (GRCm39) S91P probably damaging Het
Ints8 T A 4: 11,204,537 (GRCm39) E973V possibly damaging Het
Itga3 T C 11: 94,942,288 (GRCm39) K972R probably benign Het
Klhl33 A T 14: 51,130,478 (GRCm39) F339I probably benign Het
Krt79 T C 15: 101,846,307 (GRCm39) M214V probably benign Het
Lgsn A T 1: 31,243,274 (GRCm39) H452L probably benign Het
Limd2 C T 11: 106,049,516 (GRCm39) G124D probably benign Het
Luzp1 T C 4: 136,270,755 (GRCm39) S993P probably damaging Het
Maml2 C T 9: 13,532,481 (GRCm39) probably benign Het
Mbtd1 A T 11: 93,815,438 (GRCm39) H342L probably damaging Het
Mfhas1 C A 8: 36,058,510 (GRCm39) P995Q probably damaging Het
Muc5ac T C 7: 141,372,451 (GRCm39) F3399S possibly damaging Het
Napb T C 2: 148,542,345 (GRCm39) Y205C probably damaging Het
Odf2 G T 2: 29,802,629 (GRCm39) A298S probably benign Het
Or11g7 A T 14: 50,690,890 (GRCm39) Y127F probably benign Het
Or4s2b A T 2: 88,508,852 (GRCm39) I218F probably benign Het
Or8k35 A T 2: 86,424,488 (GRCm39) M228K probably damaging Het
Pcsk5 T C 19: 17,450,476 (GRCm39) D1124G probably benign Het
Pik3c2b T G 1: 133,030,110 (GRCm39) I1457S probably benign Het
Pole2 T C 12: 69,260,680 (GRCm39) T167A possibly damaging Het
Rfx7 T A 9: 72,525,787 (GRCm39) S992R probably damaging Het
Ryr2 G T 13: 11,727,052 (GRCm39) S2436R probably damaging Het
Sgo2a A G 1: 58,055,799 (GRCm39) D661G probably damaging Het
Sh3glb2 T A 2: 30,245,333 (GRCm39) T49S probably damaging Het
Slc16a10 T C 10: 39,932,499 (GRCm39) K354R possibly damaging Het
Slc6a6 C A 6: 91,729,419 (GRCm39) T568K probably benign Het
Sptbn1 T C 11: 30,050,633 (GRCm39) T2319A probably damaging Het
Tbl1xr1 T A 3: 22,233,454 (GRCm39) Y15N probably damaging Het
Thyn1 T C 9: 26,917,738 (GRCm39) S160P probably damaging Het
Tshz1 A T 18: 84,033,966 (GRCm39) D147E probably benign Het
Vmn2r50 T G 7: 9,771,684 (GRCm39) R672S probably benign Het
Zfp663 A T 2: 165,195,922 (GRCm39) I99N possibly damaging Het
Other mutations in Peg10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02029:Peg10 APN 6 4,754,473 (GRCm39) utr 5 prime probably benign
IGL03063:Peg10 APN 6 4,756,647 (GRCm39) utr 3 prime probably benign
piaggio UTSW 6 4,756,427 (GRCm39) utr 3 prime probably benign
PIT4480001:Peg10 UTSW 6 4,756,560 (GRCm39) missense unknown
R0090:Peg10 UTSW 6 4,756,063 (GRCm39) utr 3 prime probably benign
R0148:Peg10 UTSW 6 4,755,711 (GRCm39) missense possibly damaging 0.88
R0650:Peg10 UTSW 6 4,756,475 (GRCm39) small insertion probably benign
R0698:Peg10 UTSW 6 4,756,835 (GRCm39) utr 3 prime probably benign
R1600:Peg10 UTSW 6 4,757,080 (GRCm39) utr 3 prime probably benign
R1842:Peg10 UTSW 6 4,756,381 (GRCm39) utr 3 prime probably benign
R1930:Peg10 UTSW 6 4,755,778 (GRCm39) missense probably damaging 0.99
R1931:Peg10 UTSW 6 4,755,778 (GRCm39) missense probably damaging 0.99
R2162:Peg10 UTSW 6 4,755,914 (GRCm39) utr 3 prime probably benign
R2215:Peg10 UTSW 6 4,756,918 (GRCm39) utr 3 prime probably benign
R2339:Peg10 UTSW 6 4,756,102 (GRCm39) utr 3 prime probably benign
R2847:Peg10 UTSW 6 4,756,912 (GRCm39) utr 3 prime probably benign
R2848:Peg10 UTSW 6 4,756,912 (GRCm39) utr 3 prime probably benign
R3000:Peg10 UTSW 6 4,754,276 (GRCm39) utr 5 prime probably benign
R3056:Peg10 UTSW 6 4,755,029 (GRCm39) missense possibly damaging 0.66
R4051:Peg10 UTSW 6 4,754,534 (GRCm39) missense probably benign 0.00
R4059:Peg10 UTSW 6 4,756,427 (GRCm39) utr 3 prime probably benign
R4296:Peg10 UTSW 6 4,756,472 (GRCm39) small insertion probably benign
R4626:Peg10 UTSW 6 4,756,460 (GRCm39) small insertion probably benign
R4634:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R4679:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R4834:Peg10 UTSW 6 4,754,294 (GRCm39) utr 5 prime probably benign
R4982:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R4983:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R4996:Peg10 UTSW 6 4,756,454 (GRCm39) small insertion probably benign
R4997:Peg10 UTSW 6 4,756,457 (GRCm39) small insertion probably benign
R5015:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R5085:Peg10 UTSW 6 4,755,864 (GRCm39) utr 3 prime probably benign
R5091:Peg10 UTSW 6 4,754,511 (GRCm39) missense probably benign 0.01
R5231:Peg10 UTSW 6 4,756,939 (GRCm39) utr 3 prime probably benign
R5278:Peg10 UTSW 6 4,756,442 (GRCm39) small deletion probably benign
R5364:Peg10 UTSW 6 4,756,128 (GRCm39) utr 3 prime probably benign
R5397:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R5485:Peg10 UTSW 6 4,755,565 (GRCm39) missense probably benign 0.09
R5573:Peg10 UTSW 6 4,755,913 (GRCm39) utr 3 prime probably benign
R5710:Peg10 UTSW 6 4,756,351 (GRCm39) small insertion probably benign
R5710:Peg10 UTSW 6 4,756,350 (GRCm39) small insertion probably benign
R5736:Peg10 UTSW 6 4,754,423 (GRCm39) missense probably benign 0.00
R5865:Peg10 UTSW 6 4,754,375 (GRCm39) missense probably damaging 0.98
R6056:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R6116:Peg10 UTSW 6 4,756,351 (GRCm39) small insertion probably benign
R6129:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R6147:Peg10 UTSW 6 4,754,499 (GRCm39) start gained probably benign
R6171:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R6194:Peg10 UTSW 6 4,756,351 (GRCm39) small insertion probably benign
R6197:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R6207:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R6215:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R6276:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R6281:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R6287:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R6302:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R6393:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R6394:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R6405:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R6421:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R6486:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R6538:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R6668:Peg10 UTSW 6 4,754,502 (GRCm39) missense probably benign 0.01
R6679:Peg10 UTSW 6 4,754,276 (GRCm39) utr 5 prime probably benign
R6685:Peg10 UTSW 6 4,754,738 (GRCm39) missense probably damaging 1.00
R6702:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R6706:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R6747:Peg10 UTSW 6 4,757,137 (GRCm39) utr 3 prime probably benign
R6775:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R6811:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R6823:Peg10 UTSW 6 4,756,431 (GRCm39) small deletion probably benign
R6826:Peg10 UTSW 6 4,756,353 (GRCm39) small insertion probably benign
R6847:Peg10 UTSW 6 4,754,279 (GRCm39) utr 5 prime probably benign
R6861:Peg10 UTSW 6 4,756,351 (GRCm39) small insertion probably benign
R6861:Peg10 UTSW 6 4,756,350 (GRCm39) small insertion probably benign
R6876:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R6891:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R6911:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R6973:Peg10 UTSW 6 4,756,431 (GRCm39) small deletion probably benign
R6990:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R7070:Peg10 UTSW 6 4,756,454 (GRCm39) small insertion probably benign
R7120:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R7132:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R7140:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R7189:Peg10 UTSW 6 4,756,431 (GRCm39) small deletion probably benign
R7208:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R7256:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R7260:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R7261:Peg10 UTSW 6 4,756,591 (GRCm39) missense unknown
R7401:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R7409:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R7439:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R7475:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R7483:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R7502:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R7515:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R7520:Peg10 UTSW 6 4,756,796 (GRCm39) missense unknown
R7544:Peg10 UTSW 6 4,756,427 (GRCm39) frame shift probably null
R7571:Peg10 UTSW 6 4,756,082 (GRCm39) missense unknown
R7581:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R7635:Peg10 UTSW 6 4,754,938 (GRCm39) missense probably damaging 0.99
R7677:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R7697:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R7710:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R7803:Peg10 UTSW 6 4,756,431 (GRCm39) small deletion probably benign
R7816:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R7820:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R7827:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R7861:Peg10 UTSW 6 4,756,431 (GRCm39) small deletion probably benign
R7881:Peg10 UTSW 6 4,756,454 (GRCm39) small insertion probably benign
R7904:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R7915:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R7916:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R7963:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8016:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R8037:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R8062:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R8081:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8113:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R8115:Peg10 UTSW 6 4,756,707 (GRCm39) missense unknown
R8140:Peg10 UTSW 6 4,756,113 (GRCm39) missense unknown
R8178:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8233:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R8239:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8281:Peg10 UTSW 6 4,756,431 (GRCm39) small deletion probably benign
R8310:Peg10 UTSW 6 4,756,454 (GRCm39) small insertion probably benign
R8312:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8330:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8338:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R8354:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8387:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8390:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R8408:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R8415:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R8439:Peg10 UTSW 6 4,755,462 (GRCm39) missense possibly damaging 0.58
R8444:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R8463:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R8477:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R8507:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R8552:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8678:Peg10 UTSW 6 4,756,431 (GRCm39) small deletion probably benign
R8699:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R8700:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R8705:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R8765:Peg10 UTSW 6 4,754,492 (GRCm39) missense unknown
R8824:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R8859:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R8870:Peg10 UTSW 6 4,754,825 (GRCm39) missense probably damaging 0.99
R8909:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R8918:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R8924:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R8925:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8930:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R8950:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8960:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R8975:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8988:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9046:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9068:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R9074:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R9088:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R9094:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R9114:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9116:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9135:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R9137:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9139:Peg10 UTSW 6 4,757,128 (GRCm39) missense unknown
R9139:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R9171:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9173:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R9213:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R9216:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9229:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9233:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9283:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9328:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9367:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9369:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9405:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9410:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9412:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R9421:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9437:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R9440:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R9460:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9492:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9495:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R9500:Peg10 UTSW 6 4,756,871 (GRCm39) missense unknown
R9511:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R9515:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9576:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9610:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9611:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R9611:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9614:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R9619:Peg10 UTSW 6 4,755,316 (GRCm39) missense probably benign 0.02
R9646:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9655:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9673:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9675:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9696:Peg10 UTSW 6 4,756,431 (GRCm39) small deletion probably benign
R9749:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9756:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
X0065:Peg10 UTSW 6 4,756,515 (GRCm39) utr 3 prime probably benign
Z1176:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
Predicted Primers PCR Primer
(F):5'- CTGTTTACAGTGCCACAACCG -3'
(R):5'- CCAGCCATGTGGTAGAAGAATG -3'

Sequencing Primer
(F):5'- TCAGCATGAGCATCTGCATG -3'
(R):5'- TAGAAGAATGGTGGCTGCTG -3'
Posted On 2019-05-13