Incidental Mutation 'R6998:C1rl'
ID544342
Institutional Source Beutler Lab
Gene Symbol C1rl
Ensembl Gene ENSMUSG00000038527
Gene Namecomplement component 1, r subcomponent-like
SynonymsC1rl1, C1r-LP
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6998 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location124493113-124510643 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 124508902 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 411 (S411P)
Ref Sequence ENSEMBL: ENSMUSP00000042883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049124] [ENSMUST00000068593]
Predicted Effect probably damaging
Transcript: ENSMUST00000049124
AA Change: S411P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042883
Gene: ENSMUSG00000038527
AA Change: S411P

DomainStartEndE-ValueType
CUB 42 166 3.19e-18 SMART
Tryp_SPc 239 474 1.25e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000068593
SMART Domains Protein: ENSMUSP00000063707
Gene: ENSMUSG00000055172

DomainStartEndE-ValueType
CUB 14 140 1.56e-35 SMART
EGF_CA 141 189 1.88e-10 SMART
CUB 192 304 4.74e-35 SMART
CCP 308 370 5.56e-9 SMART
CCP 375 446 1.53e-6 SMART
Tryp_SPc 462 699 2.7e-71 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam30 A G 3: 98,162,710 R620G probably benign Het
Adcy1 A C 11: 7,079,026 N259H probably damaging Het
Ahctf1 G A 1: 179,770,915 R2* probably null Het
Akr1c21 A G 13: 4,583,851 I306M probably benign Het
Alg9 T A 9: 50,789,621 S230R possibly damaging Het
Armt1 T A 10: 4,453,937 C341S probably benign Het
Aspg T A 12: 112,112,194 L29M probably damaging Het
Aspm C T 1: 139,469,472 T934I probably damaging Het
Card14 A G 11: 119,322,899 E224G probably damaging Het
Ccdc88c T C 12: 100,916,852 H1587R probably damaging Het
Ccp110 A G 7: 118,732,897 T963A possibly damaging Het
Cdk11b G A 4: 155,648,343 W546* probably null Het
Cyp8b1 T C 9: 121,915,993 N91S probably benign Het
Dab2 G T 15: 6,424,649 M213I possibly damaging Het
Decr1 A G 4: 15,930,960 V124A probably damaging Het
Fbxl13 T A 5: 21,543,689 I411F probably damaging Het
Fbxl13 T C 5: 21,620,613 I164V probably null Het
Fndc7 G A 3: 108,876,648 A215V probably benign Het
Garem2 T C 5: 30,114,170 M210T possibly damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Ighv1-52 C A 12: 115,145,492 A115S probably benign Het
Igkv6-13 A G 6: 70,457,589 S91P probably damaging Het
Ints8 T A 4: 11,204,537 E973V possibly damaging Het
Itga3 T C 11: 95,051,462 K972R probably benign Het
Klhl33 A T 14: 50,893,021 F339I probably benign Het
Krt79 T C 15: 101,937,872 M214V probably benign Het
Lgsn A T 1: 31,204,193 H452L probably benign Het
Limd2 C T 11: 106,158,690 G124D probably benign Het
Luzp1 T C 4: 136,543,444 S993P probably damaging Het
Maml2 C T 9: 13,621,185 probably benign Het
Mbtd1 A T 11: 93,924,612 H342L probably damaging Het
Mfhas1 C A 8: 35,591,356 P995Q probably damaging Het
Muc5ac T C 7: 141,818,714 F3399S possibly damaging Het
Napb T C 2: 148,700,425 Y205C probably damaging Het
Odf2 G T 2: 29,912,617 A298S probably benign Het
Olfr1082 A T 2: 86,594,144 M228K probably damaging Het
Olfr1193 A T 2: 88,678,508 I218F probably benign Het
Olfr740 A T 14: 50,453,433 Y127F probably benign Het
Pcsk5 T C 19: 17,473,112 D1124G probably benign Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pik3c2b T G 1: 133,102,372 I1457S probably benign Het
Pole2 T C 12: 69,213,906 T167A possibly damaging Het
Rfx7 T A 9: 72,618,505 S992R probably damaging Het
Ryr2 G T 13: 11,712,166 S2436R probably damaging Het
Sgo2a A G 1: 58,016,640 D661G probably damaging Het
Sh3glb2 T A 2: 30,355,321 T49S probably damaging Het
Slc16a10 T C 10: 40,056,503 K354R possibly damaging Het
Slc6a6 C A 6: 91,752,438 T568K probably benign Het
Sptbn1 T C 11: 30,100,633 T2319A probably damaging Het
Tbl1xr1 T A 3: 22,179,290 Y15N probably damaging Het
Thyn1 T C 9: 27,006,442 S160P probably damaging Het
Tshz1 A T 18: 84,015,841 D147E probably benign Het
Vmn2r50 T G 7: 10,037,757 R672S probably benign Het
Zfp663 A T 2: 165,354,002 I99N possibly damaging Het
Other mutations in C1rl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02435:C1rl APN 6 124508873 missense probably damaging 1.00
IGL02549:C1rl APN 6 124493837 missense possibly damaging 0.76
IGL02581:C1rl APN 6 124493154 missense possibly damaging 0.83
IGL02642:C1rl APN 6 124493847 missense possibly damaging 0.60
IGL02950:C1rl APN 6 124508861 missense probably damaging 1.00
IGL02980:C1rl UTSW 6 124508528 missense probably benign 0.00
R0699:C1rl UTSW 6 124508636 missense probably benign 0.14
R0848:C1rl UTSW 6 124508506 missense probably benign 0.29
R1221:C1rl UTSW 6 124493981 missense probably benign 0.43
R1654:C1rl UTSW 6 124493910 missense probably damaging 0.97
R1957:C1rl UTSW 6 124509062 missense probably damaging 1.00
R2055:C1rl UTSW 6 124493822 missense probably benign 0.01
R2120:C1rl UTSW 6 124508713 missense probably damaging 0.99
R2262:C1rl UTSW 6 124506948 missense probably damaging 0.99
R2363:C1rl UTSW 6 124509110 missense probably benign 0.13
R3933:C1rl UTSW 6 124508822 nonsense probably null
R4824:C1rl UTSW 6 124509081 nonsense probably null
R5228:C1rl UTSW 6 124508468 missense probably damaging 1.00
R5414:C1rl UTSW 6 124508468 missense probably damaging 1.00
R6008:C1rl UTSW 6 124493188 missense probably benign 0.00
R6467:C1rl UTSW 6 124508576 missense probably benign 0.03
R6549:C1rl UTSW 6 124508528 missense probably benign 0.00
R6609:C1rl UTSW 6 124508624 missense probably benign 0.44
R7037:C1rl UTSW 6 124508639 missense probably damaging 1.00
Z1088:C1rl UTSW 6 124508742 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTCCTGGAACTTGAGCAGAG -3'
(R):5'- GCTGAGCACTTTGGTGTAGAAG -3'

Sequencing Primer
(F):5'- GAACTTGAGCAGAGAGTCCCTC -3'
(R):5'- CACTTTGGTGTAGAAGCCGTACC -3'
Posted On2019-05-13