Incidental Mutation 'R6998:Ccp110'
ID 544344
Institutional Source Beutler Lab
Gene Symbol Ccp110
Ensembl Gene ENSMUSG00000033904
Gene Name centriolar coiled coil protein 110
Synonyms 6330503K22Rik, CP110
MMRRC Submission 045010-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.889) question?
Stock # R6998 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 118311775-118336247 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 118332120 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 963 (T963A)
Ref Sequence ENSEMBL: ENSMUSP00000102167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038650] [ENSMUST00000106557]
AlphaFold Q7TSH4
Predicted Effect possibly damaging
Transcript: ENSMUST00000038650
AA Change: T963A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000038881
Gene: ENSMUSG00000033904
AA Change: T963A

DomainStartEndE-ValueType
Pfam:CALM_bind 29 135 7.4e-21 PFAM
low complexity region 241 253 N/A INTRINSIC
low complexity region 325 337 N/A INTRINSIC
coiled coil region 642 699 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106557
AA Change: T963A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102167
Gene: ENSMUSG00000033904
AA Change: T963A

DomainStartEndE-ValueType
low complexity region 50 62 N/A INTRINSIC
low complexity region 241 253 N/A INTRINSIC
low complexity region 325 337 N/A INTRINSIC
coiled coil region 642 699 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123178
Predicted Effect probably benign
Transcript: ENSMUST00000208766
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit pleiotropic phenotypes due to impaired sonic hedgehog (Shh) signaling and failure of primary cilia formation in multiple tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam30 A G 3: 98,070,026 (GRCm39) R620G probably benign Het
Adcy1 A C 11: 7,029,026 (GRCm39) N259H probably damaging Het
Ahctf1 G A 1: 179,598,480 (GRCm39) R2* probably null Het
Akr1c21 A G 13: 4,633,850 (GRCm39) I306M probably benign Het
Alg9 T A 9: 50,700,921 (GRCm39) S230R possibly damaging Het
Armt1 T A 10: 4,403,937 (GRCm39) C341S probably benign Het
Aspg T A 12: 112,078,628 (GRCm39) L29M probably damaging Het
Aspm C T 1: 139,397,210 (GRCm39) T934I probably damaging Het
C1rl T C 6: 124,485,861 (GRCm39) S411P probably damaging Het
Card14 A G 11: 119,213,725 (GRCm39) E224G probably damaging Het
Ccdc88c T C 12: 100,883,111 (GRCm39) H1587R probably damaging Het
Cdk11b G A 4: 155,732,800 (GRCm39) W546* probably null Het
Cyp8b1 T C 9: 121,745,059 (GRCm39) N91S probably benign Het
Dab2 G T 15: 6,454,130 (GRCm39) M213I possibly damaging Het
Decr1 A G 4: 15,930,960 (GRCm39) V124A probably damaging Het
Fbxl13 T A 5: 21,748,687 (GRCm39) I411F probably damaging Het
Fbxl13 T C 5: 21,825,611 (GRCm39) I164V probably null Het
Fndc7 G A 3: 108,783,964 (GRCm39) A215V probably benign Het
Garem2 T C 5: 30,319,168 (GRCm39) M210T possibly damaging Het
Gpatch2l G A 12: 86,290,958 (GRCm39) R47H probably damaging Het
Ighv1-52 C A 12: 115,109,112 (GRCm39) A115S probably benign Het
Igkv6-13 A G 6: 70,434,573 (GRCm39) S91P probably damaging Het
Ints8 T A 4: 11,204,537 (GRCm39) E973V possibly damaging Het
Itga3 T C 11: 94,942,288 (GRCm39) K972R probably benign Het
Klhl33 A T 14: 51,130,478 (GRCm39) F339I probably benign Het
Krt79 T C 15: 101,846,307 (GRCm39) M214V probably benign Het
Lgsn A T 1: 31,243,274 (GRCm39) H452L probably benign Het
Limd2 C T 11: 106,049,516 (GRCm39) G124D probably benign Het
Luzp1 T C 4: 136,270,755 (GRCm39) S993P probably damaging Het
Maml2 C T 9: 13,532,481 (GRCm39) probably benign Het
Mbtd1 A T 11: 93,815,438 (GRCm39) H342L probably damaging Het
Mfhas1 C A 8: 36,058,510 (GRCm39) P995Q probably damaging Het
Muc5ac T C 7: 141,372,451 (GRCm39) F3399S possibly damaging Het
Napb T C 2: 148,542,345 (GRCm39) Y205C probably damaging Het
Odf2 G T 2: 29,802,629 (GRCm39) A298S probably benign Het
Or11g7 A T 14: 50,690,890 (GRCm39) Y127F probably benign Het
Or4s2b A T 2: 88,508,852 (GRCm39) I218F probably benign Het
Or8k35 A T 2: 86,424,488 (GRCm39) M228K probably damaging Het
Pcsk5 T C 19: 17,450,476 (GRCm39) D1124G probably benign Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 (GRCm39) probably benign Het
Pik3c2b T G 1: 133,030,110 (GRCm39) I1457S probably benign Het
Pole2 T C 12: 69,260,680 (GRCm39) T167A possibly damaging Het
Rfx7 T A 9: 72,525,787 (GRCm39) S992R probably damaging Het
Ryr2 G T 13: 11,727,052 (GRCm39) S2436R probably damaging Het
Sgo2a A G 1: 58,055,799 (GRCm39) D661G probably damaging Het
Sh3glb2 T A 2: 30,245,333 (GRCm39) T49S probably damaging Het
Slc16a10 T C 10: 39,932,499 (GRCm39) K354R possibly damaging Het
Slc6a6 C A 6: 91,729,419 (GRCm39) T568K probably benign Het
Sptbn1 T C 11: 30,050,633 (GRCm39) T2319A probably damaging Het
Tbl1xr1 T A 3: 22,233,454 (GRCm39) Y15N probably damaging Het
Thyn1 T C 9: 26,917,738 (GRCm39) S160P probably damaging Het
Tshz1 A T 18: 84,033,966 (GRCm39) D147E probably benign Het
Vmn2r50 T G 7: 9,771,684 (GRCm39) R672S probably benign Het
Zfp663 A T 2: 165,195,922 (GRCm39) I99N possibly damaging Het
Other mutations in Ccp110
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Ccp110 APN 7 118,321,647 (GRCm39) missense possibly damaging 0.79
IGL00481:Ccp110 APN 7 118,329,220 (GRCm39) missense possibly damaging 0.70
IGL00725:Ccp110 APN 7 118,329,946 (GRCm39) missense probably damaging 0.99
IGL00899:Ccp110 APN 7 118,321,907 (GRCm39) missense probably benign
IGL01837:Ccp110 APN 7 118,324,684 (GRCm39) critical splice donor site probably null
PIT4469001:Ccp110 UTSW 7 118,321,600 (GRCm39) missense probably benign 0.06
R1217:Ccp110 UTSW 7 118,329,167 (GRCm39) splice site probably benign
R1640:Ccp110 UTSW 7 118,314,751 (GRCm39) splice site probably null
R1700:Ccp110 UTSW 7 118,334,536 (GRCm39) missense probably damaging 0.99
R1768:Ccp110 UTSW 7 118,325,247 (GRCm39) splice site probably null
R4737:Ccp110 UTSW 7 118,323,771 (GRCm39) missense possibly damaging 0.96
R4859:Ccp110 UTSW 7 118,324,653 (GRCm39) missense possibly damaging 0.93
R4933:Ccp110 UTSW 7 118,324,542 (GRCm39) missense probably damaging 0.96
R4970:Ccp110 UTSW 7 118,321,614 (GRCm39) missense possibly damaging 0.85
R4999:Ccp110 UTSW 7 118,329,235 (GRCm39) nonsense probably null
R5212:Ccp110 UTSW 7 118,328,919 (GRCm39) missense probably damaging 0.99
R5600:Ccp110 UTSW 7 118,328,948 (GRCm39) critical splice donor site probably null
R6953:Ccp110 UTSW 7 118,321,644 (GRCm39) missense possibly damaging 0.85
R7076:Ccp110 UTSW 7 118,331,628 (GRCm39) missense probably damaging 1.00
R7092:Ccp110 UTSW 7 118,334,494 (GRCm39) missense probably benign 0.26
R7336:Ccp110 UTSW 7 118,321,433 (GRCm39) missense probably damaging 0.99
R7343:Ccp110 UTSW 7 118,323,798 (GRCm39) missense probably benign 0.03
R7866:Ccp110 UTSW 7 118,322,241 (GRCm39) missense probably benign 0.07
R8306:Ccp110 UTSW 7 118,321,903 (GRCm39) missense probably benign 0.12
R8951:Ccp110 UTSW 7 118,321,015 (GRCm39) missense possibly damaging 0.70
R8961:Ccp110 UTSW 7 118,322,110 (GRCm39) missense probably damaging 0.96
R9036:Ccp110 UTSW 7 118,324,680 (GRCm39) missense probably damaging 0.98
R9252:Ccp110 UTSW 7 118,321,673 (GRCm39) missense probably benign
R9652:Ccp110 UTSW 7 118,334,553 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- TCAAGTAAGTTTAGCCTCACCAATG -3'
(R):5'- AGGAAGACTGTGTGTCCCAC -3'

Sequencing Primer
(F):5'- TTCTCCGACCAAGTGTGAAG -3'
(R):5'- CTGTGTGTCCCACTGTGACG -3'
Posted On 2019-05-13