Incidental Mutation 'R6998:Muc5ac'
ID 544345
Institutional Source Beutler Lab
Gene Symbol Muc5ac
Ensembl Gene ENSMUSG00000037974
Gene Name mucin 5, subtypes A and C, tracheobronchial/gastric
Synonyms MGM, 2210005L13Rik
MMRRC Submission 045010-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6998 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 141342709-141372968 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 141372451 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 3399 (F3399S)
Ref Sequence ENSEMBL: ENSMUSP00000122353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041924] [ENSMUST00000155534] [ENSMUST00000163321]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000041924
AA Change: F2695S

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000039699
Gene: ENSMUSG00000037974
AA Change: F2695S

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
VWD 69 226 4.19e-30 SMART
C8 258 334 1.34e-11 SMART
Pfam:TIL 337 393 1.6e-14 PFAM
VWC 395 462 8.6e-18 SMART
VWD 421 585 1.55e-33 SMART
C8 622 696 8.42e-36 SMART
Pfam:TIL 702 759 6.1e-9 PFAM
VWC 761 825 6.75e-1 SMART
VWC 863 905 4.06e-1 SMART
VWD 890 1050 1.51e-45 SMART
C8 1086 1160 2.78e-36 SMART
low complexity region 1315 1330 N/A INTRINSIC
low complexity region 1333 1366 N/A INTRINSIC
low complexity region 1371 1387 N/A INTRINSIC
Pfam:Mucin2_WxxW 1394 1482 2.3e-25 PFAM
low complexity region 1521 1532 N/A INTRINSIC
low complexity region 1536 1563 N/A INTRINSIC
low complexity region 1578 1595 N/A INTRINSIC
Pfam:Mucin2_WxxW 1604 1692 2.2e-27 PFAM
Pfam:Mucin2_WxxW 1765 1857 8.6e-27 PFAM
low complexity region 1875 1895 N/A INTRINSIC
low complexity region 1949 1968 N/A INTRINSIC
VWD 2030 2199 4.17e-48 SMART
C8 2242 2311 3.95e-9 SMART
VWC 2376 2439 1.04e-11 SMART
VWC 2479 2543 9.31e-5 SMART
CT 2625 2711 3.43e-32 SMART
low complexity region 2720 2733 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000155534
AA Change: F3399S

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000122353
Gene: ENSMUSG00000037974
AA Change: F3399S

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
VWD 69 226 4.19e-30 SMART
C8 258 334 1.34e-11 SMART
Pfam:TIL 337 393 9.6e-15 PFAM
VWC 395 437 3.54e-1 SMART
VWD 422 586 2.35e-33 SMART
C8 623 697 8.42e-36 SMART
Pfam:TIL 703 760 3.6e-9 PFAM
VWC 762 826 6.75e-1 SMART
VWC 864 906 4.06e-1 SMART
VWD 891 1051 1.51e-45 SMART
C8 1087 1161 2.78e-36 SMART
low complexity region 1316 1331 N/A INTRINSIC
low complexity region 1334 1367 N/A INTRINSIC
low complexity region 1372 1388 N/A INTRINSIC
Pfam:Mucin2_WxxW 1395 1483 1.3e-25 PFAM
low complexity region 1522 1533 N/A INTRINSIC
low complexity region 1537 1564 N/A INTRINSIC
low complexity region 1579 1596 N/A INTRINSIC
Pfam:Mucin2_WxxW 1605 1693 1.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163321
AA Change: F2695S

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000131681
Gene: ENSMUSG00000037974
AA Change: F2695S

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
VWD 69 226 4.19e-30 SMART
C8 258 334 1.34e-11 SMART
Pfam:TIL 337 393 7.9e-15 PFAM
VWC 395 462 8.6e-18 SMART
VWD 421 585 1.55e-33 SMART
C8 622 696 8.42e-36 SMART
Pfam:TIL 702 759 1.9e-9 PFAM
VWC 761 825 6.75e-1 SMART
VWC 863 905 4.06e-1 SMART
VWD 890 1050 1.51e-45 SMART
C8 1086 1160 2.78e-36 SMART
low complexity region 1315 1330 N/A INTRINSIC
low complexity region 1333 1366 N/A INTRINSIC
low complexity region 1371 1387 N/A INTRINSIC
Pfam:Mucin2_WxxW 1394 1481 1.1e-23 PFAM
low complexity region 1521 1532 N/A INTRINSIC
low complexity region 1536 1563 N/A INTRINSIC
low complexity region 1578 1595 N/A INTRINSIC
Pfam:Mucin2_WxxW 1604 1691 1.1e-25 PFAM
Pfam:Mucin2_WxxW 1765 1856 6.3e-24 PFAM
low complexity region 1875 1895 N/A INTRINSIC
low complexity region 1949 1968 N/A INTRINSIC
VWD 2030 2199 4.17e-48 SMART
C8 2242 2311 3.95e-9 SMART
VWC 2376 2439 1.04e-11 SMART
VWC 2479 2543 9.31e-5 SMART
CT 2625 2711 3.43e-32 SMART
low complexity region 2720 2733 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to T. muris infection with persistent worm burden, goblet cell hyperplasia, and increased serum IFN-gamma despite a normal TH2-type immune response. A portion of mice show corneal opacity and poor tear quality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam30 A G 3: 98,070,026 (GRCm39) R620G probably benign Het
Adcy1 A C 11: 7,029,026 (GRCm39) N259H probably damaging Het
Ahctf1 G A 1: 179,598,480 (GRCm39) R2* probably null Het
Akr1c21 A G 13: 4,633,850 (GRCm39) I306M probably benign Het
Alg9 T A 9: 50,700,921 (GRCm39) S230R possibly damaging Het
Armt1 T A 10: 4,403,937 (GRCm39) C341S probably benign Het
Aspg T A 12: 112,078,628 (GRCm39) L29M probably damaging Het
Aspm C T 1: 139,397,210 (GRCm39) T934I probably damaging Het
C1rl T C 6: 124,485,861 (GRCm39) S411P probably damaging Het
Card14 A G 11: 119,213,725 (GRCm39) E224G probably damaging Het
Ccdc88c T C 12: 100,883,111 (GRCm39) H1587R probably damaging Het
Ccp110 A G 7: 118,332,120 (GRCm39) T963A possibly damaging Het
Cdk11b G A 4: 155,732,800 (GRCm39) W546* probably null Het
Cyp8b1 T C 9: 121,745,059 (GRCm39) N91S probably benign Het
Dab2 G T 15: 6,454,130 (GRCm39) M213I possibly damaging Het
Decr1 A G 4: 15,930,960 (GRCm39) V124A probably damaging Het
Fbxl13 T A 5: 21,748,687 (GRCm39) I411F probably damaging Het
Fbxl13 T C 5: 21,825,611 (GRCm39) I164V probably null Het
Fndc7 G A 3: 108,783,964 (GRCm39) A215V probably benign Het
Garem2 T C 5: 30,319,168 (GRCm39) M210T possibly damaging Het
Gpatch2l G A 12: 86,290,958 (GRCm39) R47H probably damaging Het
Ighv1-52 C A 12: 115,109,112 (GRCm39) A115S probably benign Het
Igkv6-13 A G 6: 70,434,573 (GRCm39) S91P probably damaging Het
Ints8 T A 4: 11,204,537 (GRCm39) E973V possibly damaging Het
Itga3 T C 11: 94,942,288 (GRCm39) K972R probably benign Het
Klhl33 A T 14: 51,130,478 (GRCm39) F339I probably benign Het
Krt79 T C 15: 101,846,307 (GRCm39) M214V probably benign Het
Lgsn A T 1: 31,243,274 (GRCm39) H452L probably benign Het
Limd2 C T 11: 106,049,516 (GRCm39) G124D probably benign Het
Luzp1 T C 4: 136,270,755 (GRCm39) S993P probably damaging Het
Maml2 C T 9: 13,532,481 (GRCm39) probably benign Het
Mbtd1 A T 11: 93,815,438 (GRCm39) H342L probably damaging Het
Mfhas1 C A 8: 36,058,510 (GRCm39) P995Q probably damaging Het
Napb T C 2: 148,542,345 (GRCm39) Y205C probably damaging Het
Odf2 G T 2: 29,802,629 (GRCm39) A298S probably benign Het
Or11g7 A T 14: 50,690,890 (GRCm39) Y127F probably benign Het
Or4s2b A T 2: 88,508,852 (GRCm39) I218F probably benign Het
Or8k35 A T 2: 86,424,488 (GRCm39) M228K probably damaging Het
Pcsk5 T C 19: 17,450,476 (GRCm39) D1124G probably benign Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 (GRCm39) probably benign Het
Pik3c2b T G 1: 133,030,110 (GRCm39) I1457S probably benign Het
Pole2 T C 12: 69,260,680 (GRCm39) T167A possibly damaging Het
Rfx7 T A 9: 72,525,787 (GRCm39) S992R probably damaging Het
Ryr2 G T 13: 11,727,052 (GRCm39) S2436R probably damaging Het
Sgo2a A G 1: 58,055,799 (GRCm39) D661G probably damaging Het
Sh3glb2 T A 2: 30,245,333 (GRCm39) T49S probably damaging Het
Slc16a10 T C 10: 39,932,499 (GRCm39) K354R possibly damaging Het
Slc6a6 C A 6: 91,729,419 (GRCm39) T568K probably benign Het
Sptbn1 T C 11: 30,050,633 (GRCm39) T2319A probably damaging Het
Tbl1xr1 T A 3: 22,233,454 (GRCm39) Y15N probably damaging Het
Thyn1 T C 9: 26,917,738 (GRCm39) S160P probably damaging Het
Tshz1 A T 18: 84,033,966 (GRCm39) D147E probably benign Het
Vmn2r50 T G 7: 9,771,684 (GRCm39) R672S probably benign Het
Zfp663 A T 2: 165,195,922 (GRCm39) I99N possibly damaging Het
Other mutations in Muc5ac
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Muc5ac APN 7 141,366,440 (GRCm39) missense possibly damaging 0.93
IGL01064:Muc5ac APN 7 141,361,210 (GRCm39) missense probably benign 0.12
IGL01155:Muc5ac APN 7 141,360,680 (GRCm39) splice site probably benign
IGL01452:Muc5ac APN 7 141,371,292 (GRCm39) missense probably benign 0.00
IGL01590:Muc5ac APN 7 141,352,630 (GRCm39) missense probably benign 0.02
IGL02104:Muc5ac APN 7 141,364,815 (GRCm39) missense probably damaging 0.98
IGL02152:Muc5ac APN 7 141,353,914 (GRCm39) missense possibly damaging 0.86
IGL02153:Muc5ac APN 7 141,372,537 (GRCm39) nonsense probably null
IGL02178:Muc5ac APN 7 141,359,184 (GRCm39) splice site probably benign
IGL02403:Muc5ac APN 7 141,357,187 (GRCm39) missense possibly damaging 0.71
IGL02576:Muc5ac APN 7 141,370,781 (GRCm39) missense probably benign 0.01
IGL02665:Muc5ac APN 7 141,344,823 (GRCm39) missense possibly damaging 0.71
IGL02704:Muc5ac APN 7 141,349,000 (GRCm39) missense possibly damaging 0.71
IGL02808:Muc5ac APN 7 141,359,512 (GRCm39) missense possibly damaging 0.72
IGL03283:Muc5ac APN 7 141,367,518 (GRCm39) missense probably benign 0.34
IGL03384:Muc5ac APN 7 141,366,140 (GRCm39) missense possibly damaging 0.71
IGL03046:Muc5ac UTSW 7 141,348,950 (GRCm39) missense probably benign 0.27
PIT4515001:Muc5ac UTSW 7 141,361,153 (GRCm39) missense probably damaging 0.99
R0092:Muc5ac UTSW 7 141,372,367 (GRCm39) missense possibly damaging 0.72
R0145:Muc5ac UTSW 7 141,349,012 (GRCm39) missense possibly damaging 0.71
R0147:Muc5ac UTSW 7 141,364,776 (GRCm39) missense probably benign 0.08
R0363:Muc5ac UTSW 7 141,354,697 (GRCm39) missense probably benign 0.01
R0384:Muc5ac UTSW 7 141,365,988 (GRCm39) missense possibly damaging 0.71
R0440:Muc5ac UTSW 7 141,345,771 (GRCm39) nonsense probably null
R0583:Muc5ac UTSW 7 141,361,345 (GRCm39) missense probably damaging 0.99
R0616:Muc5ac UTSW 7 141,349,981 (GRCm39) missense probably benign 0.02
R0682:Muc5ac UTSW 7 141,359,406 (GRCm39) missense possibly damaging 0.53
R0685:Muc5ac UTSW 7 141,361,446 (GRCm39) missense probably benign 0.03
R0883:Muc5ac UTSW 7 141,350,002 (GRCm39) missense possibly damaging 0.71
R0924:Muc5ac UTSW 7 141,361,252 (GRCm39) missense possibly damaging 0.68
R1300:Muc5ac UTSW 7 141,370,666 (GRCm39) missense possibly damaging 0.73
R1315:Muc5ac UTSW 7 141,361,060 (GRCm39) missense probably damaging 0.99
R1354:Muc5ac UTSW 7 141,361,114 (GRCm39) missense probably damaging 0.99
R1484:Muc5ac UTSW 7 141,367,629 (GRCm39) splice site probably null
R1599:Muc5ac UTSW 7 141,352,640 (GRCm39) missense possibly damaging 0.52
R1758:Muc5ac UTSW 7 141,355,268 (GRCm39) missense possibly damaging 0.86
R1837:Muc5ac UTSW 7 141,360,823 (GRCm39) missense probably benign 0.00
R1911:Muc5ac UTSW 7 141,350,041 (GRCm39) missense probably benign 0.18
R1922:Muc5ac UTSW 7 141,347,426 (GRCm39) missense probably benign 0.03
R1966:Muc5ac UTSW 7 141,357,113 (GRCm39) missense possibly damaging 0.92
R1994:Muc5ac UTSW 7 141,366,889 (GRCm39) missense possibly damaging 0.93
R2056:Muc5ac UTSW 7 141,345,772 (GRCm39) missense probably benign 0.01
R2126:Muc5ac UTSW 7 141,364,479 (GRCm39) missense possibly damaging 0.84
R2170:Muc5ac UTSW 7 141,366,084 (GRCm39) missense possibly damaging 0.93
R2258:Muc5ac UTSW 7 141,344,745 (GRCm39) missense probably benign 0.41
R2259:Muc5ac UTSW 7 141,344,745 (GRCm39) missense probably benign 0.41
R2293:Muc5ac UTSW 7 141,360,936 (GRCm39) missense probably damaging 0.99
R2435:Muc5ac UTSW 7 141,371,841 (GRCm39) missense possibly damaging 0.53
R2895:Muc5ac UTSW 7 141,344,877 (GRCm39) missense possibly damaging 0.92
R2910:Muc5ac UTSW 7 141,361,378 (GRCm39) missense probably damaging 0.99
R3154:Muc5ac UTSW 7 141,346,473 (GRCm39) splice site probably null
R3762:Muc5ac UTSW 7 141,361,212 (GRCm39) missense possibly damaging 0.53
R3791:Muc5ac UTSW 7 141,352,238 (GRCm39) missense probably benign 0.32
R3806:Muc5ac UTSW 7 141,367,471 (GRCm39) missense possibly damaging 0.91
R3825:Muc5ac UTSW 7 141,368,460 (GRCm39) missense possibly damaging 0.92
R3888:Muc5ac UTSW 7 141,344,961 (GRCm39) missense possibly damaging 0.51
R3929:Muc5ac UTSW 7 141,356,629 (GRCm39) missense probably benign
R3981:Muc5ac UTSW 7 141,367,512 (GRCm39) missense possibly damaging 0.86
R4034:Muc5ac UTSW 7 141,353,581 (GRCm39) critical splice donor site probably null
R4043:Muc5ac UTSW 7 141,361,215 (GRCm39) missense possibly damaging 0.53
R4061:Muc5ac UTSW 7 141,364,867 (GRCm39) missense possibly damaging 0.85
R4106:Muc5ac UTSW 7 141,356,572 (GRCm39) missense possibly damaging 0.86
R4206:Muc5ac UTSW 7 141,370,847 (GRCm39) missense possibly damaging 0.73
R4613:Muc5ac UTSW 7 141,344,840 (GRCm39) missense possibly damaging 0.93
R4719:Muc5ac UTSW 7 141,343,500 (GRCm39) missense possibly damaging 0.83
R4751:Muc5ac UTSW 7 141,371,338 (GRCm39) missense probably benign 0.00
R4789:Muc5ac UTSW 7 141,352,619 (GRCm39) missense possibly damaging 0.86
R4928:Muc5ac UTSW 7 141,371,639 (GRCm39) nonsense probably null
R4971:Muc5ac UTSW 7 141,370,015 (GRCm39) missense possibly damaging 0.68
R4982:Muc5ac UTSW 7 141,363,193 (GRCm39) intron probably benign
R5088:Muc5ac UTSW 7 141,350,056 (GRCm39) missense possibly damaging 0.53
R5141:Muc5ac UTSW 7 141,368,479 (GRCm39) missense possibly damaging 0.72
R5224:Muc5ac UTSW 7 141,347,708 (GRCm39) missense probably benign 0.32
R5366:Muc5ac UTSW 7 141,361,287 (GRCm39) missense probably benign 0.01
R5497:Muc5ac UTSW 7 141,361,380 (GRCm39) missense probably damaging 0.99
R5507:Muc5ac UTSW 7 141,361,569 (GRCm39) missense possibly damaging 0.72
R5643:Muc5ac UTSW 7 141,347,452 (GRCm39) critical splice donor site probably null
R5811:Muc5ac UTSW 7 141,352,721 (GRCm39) missense possibly damaging 0.51
R5946:Muc5ac UTSW 7 141,371,644 (GRCm39) missense possibly damaging 0.73
R5970:Muc5ac UTSW 7 141,344,406 (GRCm39) nonsense probably null
R5977:Muc5ac UTSW 7 141,350,104 (GRCm39) missense possibly damaging 0.73
R6051:Muc5ac UTSW 7 141,365,594 (GRCm39) missense possibly damaging 0.53
R6126:Muc5ac UTSW 7 141,354,969 (GRCm39) missense possibly damaging 0.71
R6159:Muc5ac UTSW 7 141,369,323 (GRCm39) missense possibly damaging 0.53
R6256:Muc5ac UTSW 7 141,343,532 (GRCm39) missense possibly damaging 0.53
R6283:Muc5ac UTSW 7 141,370,601 (GRCm39) nonsense probably null
R6341:Muc5ac UTSW 7 141,355,229 (GRCm39) missense probably damaging 0.99
R6356:Muc5ac UTSW 7 141,366,416 (GRCm39) missense probably benign 0.05
R6481:Muc5ac UTSW 7 141,362,808 (GRCm39) intron probably benign
R6483:Muc5ac UTSW 7 141,356,591 (GRCm39) missense probably benign 0.18
R6627:Muc5ac UTSW 7 141,362,427 (GRCm39) intron probably benign
R6636:Muc5ac UTSW 7 141,372,342 (GRCm39) missense possibly damaging 0.86
R6637:Muc5ac UTSW 7 141,372,342 (GRCm39) missense possibly damaging 0.86
R6656:Muc5ac UTSW 7 141,357,065 (GRCm39) missense probably damaging 0.98
R6721:Muc5ac UTSW 7 141,352,729 (GRCm39) missense possibly damaging 0.71
R6794:Muc5ac UTSW 7 141,363,289 (GRCm39) intron probably benign
R6844:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R6847:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R6852:Muc5ac UTSW 7 141,370,644 (GRCm39) missense probably benign 0.03
R6862:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R6863:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R6864:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R6865:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R6874:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R6875:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R6876:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R6877:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R6889:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R6920:Muc5ac UTSW 7 141,347,035 (GRCm39) missense possibly damaging 0.86
R7017:Muc5ac UTSW 7 141,363,424 (GRCm39) intron probably benign
R7091:Muc5ac UTSW 7 141,363,424 (GRCm39) intron probably benign
R7092:Muc5ac UTSW 7 141,363,424 (GRCm39) intron probably benign
R7092:Muc5ac UTSW 7 141,363,385 (GRCm39) intron probably benign
R7110:Muc5ac UTSW 7 141,353,559 (GRCm39) missense possibly damaging 0.95
R7117:Muc5ac UTSW 7 141,367,559 (GRCm39) nonsense probably null
R7238:Muc5ac UTSW 7 141,363,424 (GRCm39) intron probably benign
R7238:Muc5ac UTSW 7 141,363,254 (GRCm39) missense unknown
R7396:Muc5ac UTSW 7 141,362,152 (GRCm39) missense unknown
R7456:Muc5ac UTSW 7 141,346,904 (GRCm39) missense probably benign 0.32
R7477:Muc5ac UTSW 7 141,370,019 (GRCm39) missense possibly damaging 0.72
R7530:Muc5ac UTSW 7 141,367,536 (GRCm39) missense possibly damaging 0.51
R7545:Muc5ac UTSW 7 141,362,405 (GRCm39) missense unknown
R7604:Muc5ac UTSW 7 141,363,446 (GRCm39) missense unknown
R7635:Muc5ac UTSW 7 141,359,413 (GRCm39) missense probably damaging 0.98
R7635:Muc5ac UTSW 7 141,359,490 (GRCm39) missense possibly damaging 0.53
R7650:Muc5ac UTSW 7 141,363,159 (GRCm39) missense unknown
R7651:Muc5ac UTSW 7 141,349,991 (GRCm39) missense possibly damaging 0.92
R7685:Muc5ac UTSW 7 141,363,120 (GRCm39) missense unknown
R7720:Muc5ac UTSW 7 141,363,040 (GRCm39) missense unknown
R7749:Muc5ac UTSW 7 141,363,040 (GRCm39) missense unknown
R7750:Muc5ac UTSW 7 141,363,040 (GRCm39) missense unknown
R7751:Muc5ac UTSW 7 141,363,040 (GRCm39) missense unknown
R7754:Muc5ac UTSW 7 141,363,040 (GRCm39) missense unknown
R7798:Muc5ac UTSW 7 141,347,778 (GRCm39) critical splice donor site probably null
R7835:Muc5ac UTSW 7 141,363,040 (GRCm39) missense unknown
R7837:Muc5ac UTSW 7 141,369,700 (GRCm39) missense possibly damaging 0.53
R7858:Muc5ac UTSW 7 141,357,166 (GRCm39) missense possibly damaging 0.51
R7866:Muc5ac UTSW 7 141,349,589 (GRCm39) missense probably benign 0.00
R7874:Muc5ac UTSW 7 141,363,040 (GRCm39) missense unknown
R7876:Muc5ac UTSW 7 141,363,040 (GRCm39) missense unknown
R7877:Muc5ac UTSW 7 141,363,040 (GRCm39) missense unknown
R7881:Muc5ac UTSW 7 141,363,040 (GRCm39) missense unknown
R7884:Muc5ac UTSW 7 141,363,040 (GRCm39) missense unknown
R7921:Muc5ac UTSW 7 141,363,424 (GRCm39) intron probably benign
R7976:Muc5ac UTSW 7 141,363,528 (GRCm39) missense unknown
R8104:Muc5ac UTSW 7 141,358,520 (GRCm39) missense possibly damaging 0.96
R8177:Muc5ac UTSW 7 141,361,068 (GRCm39) missense probably damaging 1.00
R8214:Muc5ac UTSW 7 141,356,685 (GRCm39) missense possibly damaging 0.53
R8292:Muc5ac UTSW 7 141,363,000 (GRCm39) missense unknown
R8386:Muc5ac UTSW 7 141,361,371 (GRCm39) missense possibly damaging 0.93
R8400:Muc5ac UTSW 7 141,364,213 (GRCm39) missense probably damaging 0.99
R8504:Muc5ac UTSW 7 141,360,892 (GRCm39) missense probably damaging 1.00
R8709:Muc5ac UTSW 7 141,370,663 (GRCm39) missense possibly damaging 0.96
R8725:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R8727:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R8754:Muc5ac UTSW 7 141,354,008 (GRCm39) missense possibly damaging 0.85
R8769:Muc5ac UTSW 7 141,372,609 (GRCm39) missense probably damaging 1.00
R8933:Muc5ac UTSW 7 141,343,493 (GRCm39) missense possibly damaging 0.59
R8939:Muc5ac UTSW 7 141,347,091 (GRCm39) missense probably damaging 0.98
R9049:Muc5ac UTSW 7 141,362,712 (GRCm39) missense unknown
R9124:Muc5ac UTSW 7 141,363,529 (GRCm39) missense unknown
R9131:Muc5ac UTSW 7 141,363,529 (GRCm39) missense unknown
R9132:Muc5ac UTSW 7 141,363,529 (GRCm39) missense unknown
R9135:Muc5ac UTSW 7 141,352,218 (GRCm39) missense probably damaging 0.99
R9156:Muc5ac UTSW 7 141,363,529 (GRCm39) missense unknown
R9157:Muc5ac UTSW 7 141,363,529 (GRCm39) missense unknown
R9159:Muc5ac UTSW 7 141,363,529 (GRCm39) missense unknown
R9160:Muc5ac UTSW 7 141,363,529 (GRCm39) missense unknown
R9161:Muc5ac UTSW 7 141,353,026 (GRCm39) missense possibly damaging 0.53
R9175:Muc5ac UTSW 7 141,366,093 (GRCm39) missense possibly damaging 0.92
R9183:Muc5ac UTSW 7 141,352,637 (GRCm39) missense possibly damaging 0.71
R9218:Muc5ac UTSW 7 141,361,098 (GRCm39) missense probably damaging 0.99
R9219:Muc5ac UTSW 7 141,370,800 (GRCm39) nonsense probably null
R9239:Muc5ac UTSW 7 141,353,954 (GRCm39) missense probably damaging 0.99
R9246:Muc5ac UTSW 7 141,364,215 (GRCm39) missense probably benign 0.11
R9287:Muc5ac UTSW 7 141,361,626 (GRCm39) missense probably damaging 0.99
R9320:Muc5ac UTSW 7 141,369,255 (GRCm39) missense probably benign 0.01
R9327:Muc5ac UTSW 7 141,365,429 (GRCm39) missense possibly damaging 0.86
R9428:Muc5ac UTSW 7 141,362,559 (GRCm39) missense unknown
R9430:Muc5ac UTSW 7 141,362,569 (GRCm39) missense unknown
R9454:Muc5ac UTSW 7 141,362,431 (GRCm39) missense unknown
R9483:Muc5ac UTSW 7 141,365,465 (GRCm39) nonsense probably null
R9581:Muc5ac UTSW 7 141,363,799 (GRCm39) missense unknown
R9610:Muc5ac UTSW 7 141,350,078 (GRCm39) missense possibly damaging 0.86
R9642:Muc5ac UTSW 7 141,349,601 (GRCm39) missense possibly damaging 0.71
R9684:Muc5ac UTSW 7 141,364,798 (GRCm39) missense probably benign 0.41
R9760:Muc5ac UTSW 7 141,360,985 (GRCm39) missense probably benign 0.05
R9778:Muc5ac UTSW 7 141,349,021 (GRCm39) nonsense probably null
X0060:Muc5ac UTSW 7 141,357,070 (GRCm39) missense possibly damaging 0.71
Z1088:Muc5ac UTSW 7 141,365,429 (GRCm39) missense possibly damaging 0.86
Z1088:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
Z1177:Muc5ac UTSW 7 141,371,777 (GRCm39) missense probably benign 0.33
Z1177:Muc5ac UTSW 7 141,362,961 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- GGGTCTTGAACAAGGGTGAC -3'
(R):5'- TACTGGAAAGGCCCAAGCATG -3'

Sequencing Primer
(F):5'- CAAGGACCTCAGGAGCTTG -3'
(R):5'- AAGCATGTCCTCGCTGAC -3'
Posted On 2019-05-13