Incidental Mutation 'R6998:Mfhas1'
ID 544346
Institutional Source Beutler Lab
Gene Symbol Mfhas1
Ensembl Gene ENSMUSG00000070056
Gene Name malignant fibrous histiocytoma amplified sequence 1
Synonyms D8Ertd91e, 2310066G09Rik
MMRRC Submission 045010-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.163) question?
Stock # R6998 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 36054952-36146603 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 36058510 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Glutamine at position 995 (P995Q)
Ref Sequence ENSEMBL: ENSMUSP00000044135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037666]
AlphaFold Q3V1N1
Predicted Effect probably damaging
Transcript: ENSMUST00000037666
AA Change: P995Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044135
Gene: ENSMUSG00000070056
AA Change: P995Q

DomainStartEndE-ValueType
LRR 58 81 1.97e1 SMART
LRR 82 105 5.72e-1 SMART
LRR 106 125 2.79e1 SMART
LRR 130 152 8.09e-1 SMART
LRR_TYP 153 175 7.78e-3 SMART
LRR 176 195 5.48e0 SMART
LRR 199 221 6.57e-1 SMART
LRR 222 244 3.98e1 SMART
LRR 245 267 1.25e-1 SMART
LRR 268 290 3.27e1 SMART
LRR 291 313 1.43e-1 SMART
LRR 314 334 1.12e1 SMART
LRR_TYP 337 360 4.11e-2 SMART
Pfam:Roc 407 537 6.9e-11 PFAM
low complexity region 743 750 N/A INTRINSIC
low complexity region 754 761 N/A INTRINSIC
low complexity region 808 820 N/A INTRINSIC
Blast:LY 1018 1038 7e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000209953
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Identified in a human 8p amplicon, this gene is a potential oncogene whose expression is enhanced in some malignant fibrous histiocytomas (MFH). The primary structure of its product includes an ATP/GTP-binding site, three leucine zipper domains, and a leucine-rich tandem repeat, which are structural or functional elements for interactions among proteins related to the cell cycle, and which suggest that overexpression might be oncogenic with respect to MFH. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam30 A G 3: 98,070,026 (GRCm39) R620G probably benign Het
Adcy1 A C 11: 7,029,026 (GRCm39) N259H probably damaging Het
Ahctf1 G A 1: 179,598,480 (GRCm39) R2* probably null Het
Akr1c21 A G 13: 4,633,850 (GRCm39) I306M probably benign Het
Alg9 T A 9: 50,700,921 (GRCm39) S230R possibly damaging Het
Armt1 T A 10: 4,403,937 (GRCm39) C341S probably benign Het
Aspg T A 12: 112,078,628 (GRCm39) L29M probably damaging Het
Aspm C T 1: 139,397,210 (GRCm39) T934I probably damaging Het
C1rl T C 6: 124,485,861 (GRCm39) S411P probably damaging Het
Card14 A G 11: 119,213,725 (GRCm39) E224G probably damaging Het
Ccdc88c T C 12: 100,883,111 (GRCm39) H1587R probably damaging Het
Ccp110 A G 7: 118,332,120 (GRCm39) T963A possibly damaging Het
Cdk11b G A 4: 155,732,800 (GRCm39) W546* probably null Het
Cyp8b1 T C 9: 121,745,059 (GRCm39) N91S probably benign Het
Dab2 G T 15: 6,454,130 (GRCm39) M213I possibly damaging Het
Decr1 A G 4: 15,930,960 (GRCm39) V124A probably damaging Het
Fbxl13 T A 5: 21,748,687 (GRCm39) I411F probably damaging Het
Fbxl13 T C 5: 21,825,611 (GRCm39) I164V probably null Het
Fndc7 G A 3: 108,783,964 (GRCm39) A215V probably benign Het
Garem2 T C 5: 30,319,168 (GRCm39) M210T possibly damaging Het
Gpatch2l G A 12: 86,290,958 (GRCm39) R47H probably damaging Het
Ighv1-52 C A 12: 115,109,112 (GRCm39) A115S probably benign Het
Igkv6-13 A G 6: 70,434,573 (GRCm39) S91P probably damaging Het
Ints8 T A 4: 11,204,537 (GRCm39) E973V possibly damaging Het
Itga3 T C 11: 94,942,288 (GRCm39) K972R probably benign Het
Klhl33 A T 14: 51,130,478 (GRCm39) F339I probably benign Het
Krt79 T C 15: 101,846,307 (GRCm39) M214V probably benign Het
Lgsn A T 1: 31,243,274 (GRCm39) H452L probably benign Het
Limd2 C T 11: 106,049,516 (GRCm39) G124D probably benign Het
Luzp1 T C 4: 136,270,755 (GRCm39) S993P probably damaging Het
Maml2 C T 9: 13,532,481 (GRCm39) probably benign Het
Mbtd1 A T 11: 93,815,438 (GRCm39) H342L probably damaging Het
Muc5ac T C 7: 141,372,451 (GRCm39) F3399S possibly damaging Het
Napb T C 2: 148,542,345 (GRCm39) Y205C probably damaging Het
Odf2 G T 2: 29,802,629 (GRCm39) A298S probably benign Het
Or11g7 A T 14: 50,690,890 (GRCm39) Y127F probably benign Het
Or4s2b A T 2: 88,508,852 (GRCm39) I218F probably benign Het
Or8k35 A T 2: 86,424,488 (GRCm39) M228K probably damaging Het
Pcsk5 T C 19: 17,450,476 (GRCm39) D1124G probably benign Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 (GRCm39) probably benign Het
Pik3c2b T G 1: 133,030,110 (GRCm39) I1457S probably benign Het
Pole2 T C 12: 69,260,680 (GRCm39) T167A possibly damaging Het
Rfx7 T A 9: 72,525,787 (GRCm39) S992R probably damaging Het
Ryr2 G T 13: 11,727,052 (GRCm39) S2436R probably damaging Het
Sgo2a A G 1: 58,055,799 (GRCm39) D661G probably damaging Het
Sh3glb2 T A 2: 30,245,333 (GRCm39) T49S probably damaging Het
Slc16a10 T C 10: 39,932,499 (GRCm39) K354R possibly damaging Het
Slc6a6 C A 6: 91,729,419 (GRCm39) T568K probably benign Het
Sptbn1 T C 11: 30,050,633 (GRCm39) T2319A probably damaging Het
Tbl1xr1 T A 3: 22,233,454 (GRCm39) Y15N probably damaging Het
Thyn1 T C 9: 26,917,738 (GRCm39) S160P probably damaging Het
Tshz1 A T 18: 84,033,966 (GRCm39) D147E probably benign Het
Vmn2r50 T G 7: 9,771,684 (GRCm39) R672S probably benign Het
Zfp663 A T 2: 165,195,922 (GRCm39) I99N possibly damaging Het
Other mutations in Mfhas1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:Mfhas1 APN 8 36,057,925 (GRCm39) missense probably benign 0.00
IGL00841:Mfhas1 APN 8 36,058,040 (GRCm39) missense probably damaging 0.97
IGL01548:Mfhas1 APN 8 36,057,613 (GRCm39) missense probably damaging 1.00
IGL02031:Mfhas1 APN 8 36,056,526 (GRCm39) missense probably damaging 0.99
IGL02093:Mfhas1 APN 8 36,056,498 (GRCm39) missense probably damaging 1.00
IGL02314:Mfhas1 APN 8 36,055,927 (GRCm39) missense probably damaging 0.98
IGL02412:Mfhas1 APN 8 36,055,969 (GRCm39) missense probably benign 0.11
IGL02638:Mfhas1 APN 8 36,058,104 (GRCm39) missense possibly damaging 0.55
IGL02663:Mfhas1 APN 8 36,057,060 (GRCm39) missense probably damaging 0.99
R0545:Mfhas1 UTSW 8 36,056,202 (GRCm39) missense probably damaging 1.00
R0619:Mfhas1 UTSW 8 36,057,829 (GRCm39) missense probably benign 0.00
R0637:Mfhas1 UTSW 8 36,057,180 (GRCm39) nonsense probably null
R1251:Mfhas1 UTSW 8 36,058,207 (GRCm39) missense probably damaging 0.97
R1829:Mfhas1 UTSW 8 36,057,402 (GRCm39) missense probably benign 0.09
R1829:Mfhas1 UTSW 8 36,057,222 (GRCm39) missense probably benign
R1839:Mfhas1 UTSW 8 36,058,012 (GRCm39) missense possibly damaging 0.95
R1934:Mfhas1 UTSW 8 36,058,251 (GRCm39) missense possibly damaging 0.52
R1937:Mfhas1 UTSW 8 36,056,799 (GRCm39) missense probably damaging 0.99
R2038:Mfhas1 UTSW 8 36,058,431 (GRCm39) missense probably damaging 1.00
R2982:Mfhas1 UTSW 8 36,058,269 (GRCm39) missense probably benign 0.07
R4566:Mfhas1 UTSW 8 36,058,203 (GRCm39) missense probably damaging 1.00
R4604:Mfhas1 UTSW 8 36,055,764 (GRCm39) missense probably benign 0.00
R4693:Mfhas1 UTSW 8 36,056,329 (GRCm39) missense probably damaging 1.00
R5205:Mfhas1 UTSW 8 36,058,161 (GRCm39) missense probably benign 0.10
R5535:Mfhas1 UTSW 8 36,057,423 (GRCm39) missense possibly damaging 0.73
R5631:Mfhas1 UTSW 8 36,055,573 (GRCm39) missense probably damaging 0.96
R5744:Mfhas1 UTSW 8 36,056,636 (GRCm39) missense probably damaging 1.00
R6580:Mfhas1 UTSW 8 36,056,419 (GRCm39) missense probably damaging 1.00
R6663:Mfhas1 UTSW 8 36,056,272 (GRCm39) missense probably damaging 1.00
R7046:Mfhas1 UTSW 8 36,131,944 (GRCm39) missense probably benign 0.00
R7054:Mfhas1 UTSW 8 36,055,792 (GRCm39) missense probably benign 0.30
R7171:Mfhas1 UTSW 8 36,056,146 (GRCm39) missense probably benign 0.08
R7396:Mfhas1 UTSW 8 36,057,353 (GRCm39) missense probably damaging 0.97
R7557:Mfhas1 UTSW 8 36,056,758 (GRCm39) missense possibly damaging 0.50
R7853:Mfhas1 UTSW 8 36,057,025 (GRCm39) nonsense probably null
R7876:Mfhas1 UTSW 8 36,056,697 (GRCm39) missense probably damaging 1.00
R8815:Mfhas1 UTSW 8 36,057,394 (GRCm39) missense probably damaging 0.99
R9009:Mfhas1 UTSW 8 36,057,109 (GRCm39) missense probably damaging 1.00
R9214:Mfhas1 UTSW 8 36,057,730 (GRCm39) missense probably damaging 1.00
R9281:Mfhas1 UTSW 8 36,057,951 (GRCm39) missense probably benign 0.01
R9573:Mfhas1 UTSW 8 36,143,903 (GRCm39) missense possibly damaging 0.72
R9783:Mfhas1 UTSW 8 36,057,934 (GRCm39) missense probably damaging 1.00
X0060:Mfhas1 UTSW 8 36,055,558 (GRCm39) missense possibly damaging 0.52
Z1088:Mfhas1 UTSW 8 36,057,390 (GRCm39) missense probably benign 0.04
Z1177:Mfhas1 UTSW 8 36,057,539 (GRCm39) missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TGGTGAGTTACAGACCTGCC -3'
(R):5'- AAGAGAATGATGCTCGTGGC -3'

Sequencing Primer
(F):5'- GACACCCTGTCCATTGCCAG -3'
(R):5'- TGGCAGCATTTCACCTGG -3'
Posted On 2019-05-13