Incidental Mutation 'R6998:Maml2'
ID544347
Institutional Source Beutler Lab
Gene Symbol Maml2
Ensembl Gene ENSMUSG00000031925
Gene Namemastermind like transcriptional coactivator 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6998 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location13297957-13709388 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 13621185 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000034401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034401] [ENSMUST00000159294]
Predicted Effect probably benign
Transcript: ENSMUST00000034401
SMART Domains Protein: ENSMUSP00000034401
Gene: ENSMUSG00000031925

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
low complexity region 144 163 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000124083
Gene: ENSMUSG00000031925
AA Change: A565V

DomainStartEndE-ValueType
low complexity region 227 245 N/A INTRINSIC
low complexity region 313 331 N/A INTRINSIC
SCOP:d1lsha3 385 459 5e-3 SMART
low complexity region 523 547 N/A INTRINSIC
low complexity region 571 589 N/A INTRINSIC
low complexity region 616 627 N/A INTRINSIC
low complexity region 734 753 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam30 A G 3: 98,162,710 R620G probably benign Het
Adcy1 A C 11: 7,079,026 N259H probably damaging Het
Ahctf1 G A 1: 179,770,915 R2* probably null Het
Akr1c21 A G 13: 4,583,851 I306M probably benign Het
Alg9 T A 9: 50,789,621 S230R possibly damaging Het
Armt1 T A 10: 4,453,937 C341S probably benign Het
Aspg T A 12: 112,112,194 L29M probably damaging Het
Aspm C T 1: 139,469,472 T934I probably damaging Het
C1rl T C 6: 124,508,902 S411P probably damaging Het
Card14 A G 11: 119,322,899 E224G probably damaging Het
Ccdc88c T C 12: 100,916,852 H1587R probably damaging Het
Ccp110 A G 7: 118,732,897 T963A possibly damaging Het
Cdk11b G A 4: 155,648,343 W546* probably null Het
Cyp8b1 T C 9: 121,915,993 N91S probably benign Het
Dab2 G T 15: 6,424,649 M213I possibly damaging Het
Decr1 A G 4: 15,930,960 V124A probably damaging Het
Fbxl13 T A 5: 21,543,689 I411F probably damaging Het
Fbxl13 T C 5: 21,620,613 I164V probably null Het
Fndc7 G A 3: 108,876,648 A215V probably benign Het
Garem2 T C 5: 30,114,170 M210T possibly damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Ighv1-52 C A 12: 115,145,492 A115S probably benign Het
Igkv6-13 A G 6: 70,457,589 S91P probably damaging Het
Ints8 T A 4: 11,204,537 E973V possibly damaging Het
Itga3 T C 11: 95,051,462 K972R probably benign Het
Klhl33 A T 14: 50,893,021 F339I probably benign Het
Krt79 T C 15: 101,937,872 M214V probably benign Het
Lgsn A T 1: 31,204,193 H452L probably benign Het
Limd2 C T 11: 106,158,690 G124D probably benign Het
Luzp1 T C 4: 136,543,444 S993P probably damaging Het
Mbtd1 A T 11: 93,924,612 H342L probably damaging Het
Mfhas1 C A 8: 35,591,356 P995Q probably damaging Het
Muc5ac T C 7: 141,818,714 F3399S possibly damaging Het
Napb T C 2: 148,700,425 Y205C probably damaging Het
Odf2 G T 2: 29,912,617 A298S probably benign Het
Olfr1082 A T 2: 86,594,144 M228K probably damaging Het
Olfr1193 A T 2: 88,678,508 I218F probably benign Het
Olfr740 A T 14: 50,453,433 Y127F probably benign Het
Pcsk5 T C 19: 17,473,112 D1124G probably benign Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pik3c2b T G 1: 133,102,372 I1457S probably benign Het
Pole2 T C 12: 69,213,906 T167A possibly damaging Het
Rfx7 T A 9: 72,618,505 S992R probably damaging Het
Ryr2 G T 13: 11,712,166 S2436R probably damaging Het
Sgo2a A G 1: 58,016,640 D661G probably damaging Het
Sh3glb2 T A 2: 30,355,321 T49S probably damaging Het
Slc16a10 T C 10: 40,056,503 K354R possibly damaging Het
Slc6a6 C A 6: 91,752,438 T568K probably benign Het
Sptbn1 T C 11: 30,100,633 T2319A probably damaging Het
Tbl1xr1 T A 3: 22,179,290 Y15N probably damaging Het
Thyn1 T C 9: 27,006,442 S160P probably damaging Het
Tshz1 A T 18: 84,015,841 D147E probably benign Het
Vmn2r50 T G 7: 10,037,757 R672S probably benign Het
Zfp663 A T 2: 165,354,002 I99N possibly damaging Het
Other mutations in Maml2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Maml2 APN 9 13621604 unclassified probably benign
IGL00424:Maml2 APN 9 13620912 missense probably damaging 0.99
IGL02711:Maml2 APN 9 13620063 missense probably benign 0.14
IGL03079:Maml2 APN 9 13621616 unclassified probably benign
IGL03217:Maml2 APN 9 13619999 missense probably damaging 1.00
FR4304:Maml2 UTSW 9 13621459 small deletion probably benign
FR4449:Maml2 UTSW 9 13621456 small deletion probably benign
PIT4810001:Maml2 UTSW 9 13620024 missense
R0102:Maml2 UTSW 9 13705932 synonymous silent
R0318:Maml2 UTSW 9 13620594 missense probably damaging 0.99
R0380:Maml2 UTSW 9 13621100 nonsense probably null
R1433:Maml2 UTSW 9 13706501 missense probably damaging 1.00
R1449:Maml2 UTSW 9 13620684 missense possibly damaging 0.85
R1789:Maml2 UTSW 9 13697345 missense probably damaging 1.00
R2173:Maml2 UTSW 9 13621616 unclassified probably benign
R2363:Maml2 UTSW 9 13621245 missense probably damaging 1.00
R2426:Maml2 UTSW 9 13706498 missense probably damaging 1.00
R2880:Maml2 UTSW 9 13620597 unclassified probably null
R3981:Maml2 UTSW 9 13621068 missense possibly damaging 0.80
R4094:Maml2 UTSW 9 13620153 missense probably benign 0.22
R4117:Maml2 UTSW 9 13705934 missense probably damaging 1.00
R4282:Maml2 UTSW 9 13620110 missense possibly damaging 0.93
R4618:Maml2 UTSW 9 13620075 missense probably damaging 1.00
R4921:Maml2 UTSW 9 13621175 missense probably damaging 1.00
R4957:Maml2 UTSW 9 13620276 missense probably damaging 1.00
R5195:Maml2 UTSW 9 13621114 missense probably damaging 0.98
R5428:Maml2 UTSW 9 13705895 missense probably benign 0.30
R5448:Maml2 UTSW 9 13706467 missense probably damaging 0.98
R5450:Maml2 UTSW 9 13706467 missense probably damaging 0.98
R5455:Maml2 UTSW 9 13705743 nonsense probably null
R5620:Maml2 UTSW 9 13697320 missense probably damaging 1.00
R5973:Maml2 UTSW 9 13621619 unclassified probably benign
R6009:Maml2 UTSW 9 13620998 missense probably benign 0.02
R6054:Maml2 UTSW 9 13621399 small deletion probably benign
R6257:Maml2 UTSW 9 13620426 missense probably damaging 1.00
R6727:Maml2 UTSW 9 13621551 unclassified probably benign
R6824:Maml2 UTSW 9 13697217 missense possibly damaging 0.67
R6854:Maml2 UTSW 9 13705835 missense possibly damaging 0.59
R7047:Maml2 UTSW 9 13620881 unclassified probably benign
R7233:Maml2 UTSW 9 13620771 missense
R7326:Maml2 UTSW 9 13621607 missense
R7612:Maml2 UTSW 9 13706485 missense probably benign 0.04
R7652:Maml2 UTSW 9 13621649 missense
R7699:Maml2 UTSW 9 13621089 missense
R7700:Maml2 UTSW 9 13621089 missense
R7803:Maml2 UTSW 9 13621254 small insertion probably benign
R7803:Maml2 UTSW 9 13621275 small insertion probably benign
R7803:Maml2 UTSW 9 13621276 small insertion probably benign
RF015:Maml2 UTSW 9 13621456 small deletion probably benign
RF044:Maml2 UTSW 9 13621456 small deletion probably benign
X0063:Maml2 UTSW 9 13620341 missense probably benign 0.09
Z1177:Maml2 UTSW 9 13706590 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CGGCCAATTACACGTACAAGG -3'
(R):5'- ATAAAGCATGGGTGGGTTGC -3'

Sequencing Primer
(F):5'- TTACACGTACAAGGCCAGC -3'
(R):5'- TGCTGAGCTGTCAATGAACC -3'
Posted On2019-05-13