Mutagenetix > Incidental Mutation

Incidental Mutation 'R6998:Cyp8b1'

544351

Institutional Source

Beutler Lab

Gene Symbol

Cyp8b1

Ensembl Gene

ENSMUSG00000050445

Gene Name

cytochrome P450, family 8, subfamily b, polypeptide 1

Synonyms

sterol 12-alpha-hydrolase

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.327) question?

Stock #

R6998 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

121914356-121916305 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 121915993 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 91 (N91S)

Ref Sequence

ENSEMBL: ENSMUSP00000052989 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050327] [ENSMUST00000062474] [ENSMUST00000214340]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000050327

SMART Domains

Protein: ENSMUSP00000050119
Gene: ENSMUSG00000044534

Domain	Start	End	E-Value	Type
low complexity region	18	29	N/A	INTRINSIC
Pfam:7tm_1	62	311	1e-40	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000062474
AA Change: N91S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000052989
Gene: ENSMUSG00000050445
AA Change: N91S

Domain	Start	End	E-Value	Type
low complexity region	11	24	N/A	INTRINSIC
Pfam:p450	32	492	5.7e-50	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000214340

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum membrane protein catalyzes the conversion of 7 alpha-hydroxy-4-cholesten-3-one into 7-alpha,12-alpha-dihydroxy-4-cholesten-3-one. The balance between these two steroids determines the relative amounts of cholic acid and chenodeoxycholic acid both of which are secreted in the bile and affect the solubility of cholesterol. This gene is unique among the cytochrome P450 genes in that it is intronless. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele lack synthsesis of cholate (a primary bile acid) and its metabolites and display an increased bile acid pool and alterations in cholesterol metabolism. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam30	A	G	3: 98,162,710	R620G	probably benign	Het
Adcy1	A	C	11: 7,079,026	N259H	probably damaging	Het
Ahctf1	G	A	1: 179,770,915	R2*	probably null	Het
Akr1c21	A	G	13: 4,583,851	I306M	probably benign	Het
Alg9	T	A	9: 50,789,621	S230R	possibly damaging	Het
Armt1	T	A	10: 4,453,937	C341S	probably benign	Het
Aspg	T	A	12: 112,112,194	L29M	probably damaging	Het
Aspm	C	T	1: 139,469,472	T934I	probably damaging	Het
C1rl	T	C	6: 124,508,902	S411P	probably damaging	Het
Card14	A	G	11: 119,322,899	E224G	probably damaging	Het
Ccdc88c	T	C	12: 100,916,852	H1587R	probably damaging	Het
Ccp110	A	G	7: 118,732,897	T963A	possibly damaging	Het
Cdk11b	G	A	4: 155,648,343	W546*	probably null	Het
Dab2	G	T	15: 6,424,649	M213I	possibly damaging	Het
Decr1	A	G	4: 15,930,960	V124A	probably damaging	Het
Fbxl13	T	A	5: 21,543,689	I411F	probably damaging	Het
Fbxl13	T	C	5: 21,620,613	I164V	probably null	Het
Fndc7	G	A	3: 108,876,648	A215V	probably benign	Het
Garem2	T	C	5: 30,114,170	M210T	possibly damaging	Het
Gpatch2l	G	A	12: 86,244,184	R47H	probably damaging	Het
Ighv1-52	C	A	12: 115,145,492	A115S	probably benign	Het
Igkv6-13	A	G	6: 70,457,589	S91P	probably damaging	Het
Ints8	T	A	4: 11,204,537	E973V	possibly damaging	Het
Itga3	T	C	11: 95,051,462	K972R	probably benign	Het
Klhl33	A	T	14: 50,893,021	F339I	probably benign	Het
Krt79	T	C	15: 101,937,872	M214V	probably benign	Het
Lgsn	A	T	1: 31,204,193	H452L	probably benign	Het
Limd2	C	T	11: 106,158,690	G124D	probably benign	Het
Luzp1	T	C	4: 136,543,444	S993P	probably damaging	Het
Maml2	C	T	9: 13,621,185		probably benign	Het
Mbtd1	A	T	11: 93,924,612	H342L	probably damaging	Het
Mfhas1	C	A	8: 35,591,356	P995Q	probably damaging	Het
Muc5ac	T	C	7: 141,818,714	F3399S	possibly damaging	Het
Napb	T	C	2: 148,700,425	Y205C	probably damaging	Het
Odf2	G	T	2: 29,912,617	A298S	probably benign	Het
Olfr1082	A	T	2: 86,594,144	M228K	probably damaging	Het
Olfr1193	A	T	2: 88,678,508	I218F	probably benign	Het
Olfr740	A	T	14: 50,453,433	Y127F	probably benign	Het
Pcsk5	T	C	19: 17,473,112	D1124G	probably benign	Het
Peg10	CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG	CCACATCAGGATCCACATCAGGATGCACATCAG	6: 4,756,398		probably benign	Het
Pik3c2b	T	G	1: 133,102,372	I1457S	probably benign	Het
Pole2	T	C	12: 69,213,906	T167A	possibly damaging	Het
Rfx7	T	A	9: 72,618,505	S992R	probably damaging	Het
Ryr2	G	T	13: 11,712,166	S2436R	probably damaging	Het
Sgo2a	A	G	1: 58,016,640	D661G	probably damaging	Het
Sh3glb2	T	A	2: 30,355,321	T49S	probably damaging	Het
Slc16a10	T	C	10: 40,056,503	K354R	possibly damaging	Het
Slc6a6	C	A	6: 91,752,438	T568K	probably benign	Het
Sptbn1	T	C	11: 30,100,633	T2319A	probably damaging	Het
Tbl1xr1	T	A	3: 22,179,290	Y15N	probably damaging	Het
Thyn1	T	C	9: 27,006,442	S160P	probably damaging	Het
Tshz1	A	T	18: 84,015,841	D147E	probably benign	Het
Vmn2r50	T	G	7: 10,037,757	R672S	probably benign	Het
Zfp663	A	T	2: 165,354,002	I99N	possibly damaging	Het

Other mutations in Cyp8b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01527:Cyp8b1	APN	9	121914995	missense	probably damaging	0.98
IGL01874:Cyp8b1	APN	9	121915903	missense	possibly damaging	0.71
IGL02004:Cyp8b1	APN	9	121914992	missense	probably benign	0.01
IGL02218:Cyp8b1	APN	9	121915117	missense	probably damaging	1.00
IGL02606:Cyp8b1	APN	9	121915735	missense	probably damaging	1.00
IGL02724:Cyp8b1	APN	9	121915387	missense	probably benign	0.12
IGL02796:Cyp8b1	UTSW	9	121915498	missense	probably benign
R1052:Cyp8b1	UTSW	9	121915282	missense	possibly damaging	0.67
R1223:Cyp8b1	UTSW	9	121915004	missense	possibly damaging	0.71
R1572:Cyp8b1	UTSW	9	121914958	missense	possibly damaging	0.94
R1639:Cyp8b1	UTSW	9	121914890	missense	probably benign	0.01
R3833:Cyp8b1	UTSW	9	121916043	missense	probably benign	0.00
R3938:Cyp8b1	UTSW	9	121915618	missense	probably benign	0.05
R4151:Cyp8b1	UTSW	9	121916068	missense	probably damaging	1.00
R4615:Cyp8b1	UTSW	9	121916098	nonsense	probably null
R4625:Cyp8b1	UTSW	9	121915585	missense	probably damaging	0.99
R5327:Cyp8b1	UTSW	9	121914884	missense	probably damaging	0.99
R6391:Cyp8b1	UTSW	9	121915798	nonsense	probably null
R7086:Cyp8b1	UTSW	9	121915289	missense	probably benign	0.02
R7162:Cyp8b1	UTSW	9	121915711	missense	probably damaging	0.99
R7210:Cyp8b1	UTSW	9	121915180	missense	probably damaging	1.00
R7223:Cyp8b1	UTSW	9	121915097	missense	probably damaging	1.00
R8352:Cyp8b1	UTSW	9	121915931	missense	probably damaging	0.97
R8392:Cyp8b1	UTSW	9	121915234	missense	probably damaging	0.98
R8452:Cyp8b1	UTSW	9	121915931	missense	probably damaging	0.97
R8672:Cyp8b1	UTSW	9	121914920	missense	probably benign	0.00
R8897:Cyp8b1	UTSW	9	121916292	start gained	probably benign
R9484:Cyp8b1	UTSW	9	121915917	missense	probably benign	0.00
R9764:Cyp8b1	UTSW	9	121915228	missense	probably benign	0.03
RF013:Cyp8b1	UTSW	9	121915495	missense	possibly damaging	0.59
Z1177:Cyp8b1	UTSW	9	121915531	missense	probably benign	0.06
Z1177:Cyp8b1	UTSW	9	121916146	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGAGGCCATCTTCACACCAG -3'
(R):5'- ACCTCTGGACAAGGGTTTTG -3'

Sequencing Primer
(F):5'- TAGCATCACCAAGGATAGGCTGTC -3'
(R):5'- GGGTTTTGTGCCCTGGC -3'

Posted On

2019-05-13