Incidental Mutation 'R6998:Limd2'
ID544358
Institutional Source Beutler Lab
Gene Symbol Limd2
Ensembl Gene ENSMUSG00000040699
Gene NameLIM domain containing 2
Synonyms0610025L06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R6998 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location106156256-106160860 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 106158690 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 124 (G124D)
Ref Sequence ENSEMBL: ENSMUSP00000102488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002044] [ENSMUST00000007444] [ENSMUST00000045923] [ENSMUST00000064545] [ENSMUST00000100326] [ENSMUST00000106875]
Predicted Effect probably benign
Transcript: ENSMUST00000002044
SMART Domains Protein: ENSMUSP00000002044
Gene: ENSMUSG00000020700

DomainStartEndE-ValueType
PB1 44 123 1.04e-18 SMART
S_TKc 362 622 4.23e-95 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000007444
SMART Domains Protein: ENSMUSP00000007444
Gene: ENSMUSG00000069631

DomainStartEndE-ValueType
Pfam:Pkinase 69 379 2.4e-37 PFAM
Pfam:Pkinase_Tyr 70 302 2.1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045923
AA Change: G124D

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000045357
Gene: ENSMUSG00000040699
AA Change: G124D

DomainStartEndE-ValueType
LIM 40 92 3.93e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000064545
AA Change: G124D

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000067070
Gene: ENSMUSG00000040699
AA Change: G124D

DomainStartEndE-ValueType
LIM 40 92 3.93e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100326
SMART Domains Protein: ENSMUSP00000097900
Gene: ENSMUSG00000075480

DomainStartEndE-ValueType
low complexity region 39 54 N/A INTRINSIC
low complexity region 61 74 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106875
AA Change: G124D

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000102488
Gene: ENSMUSG00000040699
AA Change: G124D

DomainStartEndE-ValueType
LIM 40 92 3.93e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam30 A G 3: 98,162,710 R620G probably benign Het
Adcy1 A C 11: 7,079,026 N259H probably damaging Het
Ahctf1 G A 1: 179,770,915 R2* probably null Het
Akr1c21 A G 13: 4,583,851 I306M probably benign Het
Alg9 T A 9: 50,789,621 S230R possibly damaging Het
Armt1 T A 10: 4,453,937 C341S probably benign Het
Aspg T A 12: 112,112,194 L29M probably damaging Het
Aspm C T 1: 139,469,472 T934I probably damaging Het
C1rl T C 6: 124,508,902 S411P probably damaging Het
Card14 A G 11: 119,322,899 E224G probably damaging Het
Ccdc88c T C 12: 100,916,852 H1587R probably damaging Het
Ccp110 A G 7: 118,732,897 T963A possibly damaging Het
Cdk11b G A 4: 155,648,343 W546* probably null Het
Cyp8b1 T C 9: 121,915,993 N91S probably benign Het
Dab2 G T 15: 6,424,649 M213I possibly damaging Het
Decr1 A G 4: 15,930,960 V124A probably damaging Het
Fbxl13 T A 5: 21,543,689 I411F probably damaging Het
Fbxl13 T C 5: 21,620,613 I164V probably null Het
Fndc7 G A 3: 108,876,648 A215V probably benign Het
Garem2 T C 5: 30,114,170 M210T possibly damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Ighv1-52 C A 12: 115,145,492 A115S probably benign Het
Igkv6-13 A G 6: 70,457,589 S91P probably damaging Het
Ints8 T A 4: 11,204,537 E973V possibly damaging Het
Itga3 T C 11: 95,051,462 K972R probably benign Het
Klhl33 A T 14: 50,893,021 F339I probably benign Het
Krt79 T C 15: 101,937,872 M214V probably benign Het
Lgsn A T 1: 31,204,193 H452L probably benign Het
Luzp1 T C 4: 136,543,444 S993P probably damaging Het
Maml2 C T 9: 13,621,185 probably benign Het
Mbtd1 A T 11: 93,924,612 H342L probably damaging Het
Mfhas1 C A 8: 35,591,356 P995Q probably damaging Het
Muc5ac T C 7: 141,818,714 F3399S possibly damaging Het
Napb T C 2: 148,700,425 Y205C probably damaging Het
Odf2 G T 2: 29,912,617 A298S probably benign Het
Olfr1082 A T 2: 86,594,144 M228K probably damaging Het
Olfr1193 A T 2: 88,678,508 I218F probably benign Het
Olfr740 A T 14: 50,453,433 Y127F probably benign Het
Pcsk5 T C 19: 17,473,112 D1124G probably benign Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pik3c2b T G 1: 133,102,372 I1457S probably benign Het
Pole2 T C 12: 69,213,906 T167A possibly damaging Het
Rfx7 T A 9: 72,618,505 S992R probably damaging Het
Ryr2 G T 13: 11,712,166 S2436R probably damaging Het
Sgo2a A G 1: 58,016,640 D661G probably damaging Het
Sh3glb2 T A 2: 30,355,321 T49S probably damaging Het
Slc16a10 T C 10: 40,056,503 K354R possibly damaging Het
Slc6a6 C A 6: 91,752,438 T568K probably benign Het
Sptbn1 T C 11: 30,100,633 T2319A probably damaging Het
Tbl1xr1 T A 3: 22,179,290 Y15N probably damaging Het
Thyn1 T C 9: 27,006,442 S160P probably damaging Het
Tshz1 A T 18: 84,015,841 D147E probably benign Het
Vmn2r50 T G 7: 10,037,757 R672S probably benign Het
Zfp663 A T 2: 165,354,002 I99N possibly damaging Het
Other mutations in Limd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Limd2 APN 11 106159205 missense probably benign
IGL01516:Limd2 APN 11 106159044 missense probably benign
R2088:Limd2 UTSW 11 106158742 missense probably damaging 0.99
R4870:Limd2 UTSW 11 106159389 start codon destroyed probably null 0.36
R6807:Limd2 UTSW 11 106158945 missense probably benign
R6846:Limd2 UTSW 11 106159387 start codon destroyed probably null 0.57
R7877:Limd2 UTSW 11 106159178 missense probably benign 0.29
R7960:Limd2 UTSW 11 106159178 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- CTTGCTGGAGAAAAGGCACC -3'
(R):5'- CAGACTGACCCAGATGTTCTC -3'

Sequencing Primer
(F):5'- GGTGAAAATTCCAATTCTGGTTCCC -3'
(R):5'- AGATGTTCTCTGCTTCCACAG -3'
Posted On2019-05-13