Incidental Mutation 'R6998:Card14'
ID544359
Institutional Source Beutler Lab
Gene Symbol Card14
Ensembl Gene ENSMUSG00000013483
Gene Namecaspase recruitment domain family, member 14
SynonymsBimp2, CARMA2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R6998 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location119307768-119345375 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119322899 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 224 (E224G)
Ref Sequence ENSEMBL: ENSMUSP00000101857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053245] [ENSMUST00000106250]
Predicted Effect probably damaging
Transcript: ENSMUST00000053245
AA Change: E224G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053665
Gene: ENSMUSG00000013483
AA Change: E224G

DomainStartEndE-ValueType
Pfam:CARD 20 106 4.1e-25 PFAM
coiled coil region 126 173 N/A INTRINSIC
low complexity region 240 250 N/A INTRINSIC
low complexity region 262 275 N/A INTRINSIC
coiled coil region 280 377 N/A INTRINSIC
low complexity region 438 450 N/A INTRINSIC
low complexity region 473 483 N/A INTRINSIC
low complexity region 541 551 N/A INTRINSIC
PDZ 578 657 5.51e-3 SMART
Blast:SH3 676 735 4e-25 BLAST
low complexity region 736 746 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
Blast:GuKc 826 989 4e-63 BLAST
SCOP:d1kjwa2 855 994 2e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106250
AA Change: E224G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101857
Gene: ENSMUSG00000013483
AA Change: E224G

DomainStartEndE-ValueType
Pfam:CARD 20 106 2.8e-25 PFAM
coiled coil region 126 173 N/A INTRINSIC
low complexity region 240 250 N/A INTRINSIC
low complexity region 262 275 N/A INTRINSIC
coiled coil region 280 377 N/A INTRINSIC
low complexity region 438 450 N/A INTRINSIC
low complexity region 473 483 N/A INTRINSIC
low complexity region 541 551 N/A INTRINSIC
PDZ 578 657 5.51e-3 SMART
Blast:SH3 676 735 4e-25 BLAST
low complexity region 736 746 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
Blast:GuKc 826 989 4e-63 BLAST
SCOP:d1kjwa2 855 994 2e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a caspase recruitment domain-containing protein that is a member of the membrane-associated guanylate kinase (MAGUK) family of proteins. Members of this protein family are scaffold proteins that are involved in a diverse array of cellular processes including cellular adhesion, signal transduction and cell polarity control. This protein has been shown to specifically interact with BCL10, a protein known to function as a positive regulator of cell apoptosis and NF-kappaB activation. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2012]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam30 A G 3: 98,162,710 R620G probably benign Het
Adcy1 A C 11: 7,079,026 N259H probably damaging Het
Ahctf1 G A 1: 179,770,915 R2* probably null Het
Akr1c21 A G 13: 4,583,851 I306M probably benign Het
Alg9 T A 9: 50,789,621 S230R possibly damaging Het
Armt1 T A 10: 4,453,937 C341S probably benign Het
Aspg T A 12: 112,112,194 L29M probably damaging Het
Aspm C T 1: 139,469,472 T934I probably damaging Het
C1rl T C 6: 124,508,902 S411P probably damaging Het
Ccdc88c T C 12: 100,916,852 H1587R probably damaging Het
Ccp110 A G 7: 118,732,897 T963A possibly damaging Het
Cdk11b G A 4: 155,648,343 W546* probably null Het
Cyp8b1 T C 9: 121,915,993 N91S probably benign Het
Dab2 G T 15: 6,424,649 M213I possibly damaging Het
Decr1 A G 4: 15,930,960 V124A probably damaging Het
Fbxl13 T A 5: 21,543,689 I411F probably damaging Het
Fbxl13 T C 5: 21,620,613 I164V probably null Het
Fndc7 G A 3: 108,876,648 A215V probably benign Het
Garem2 T C 5: 30,114,170 M210T possibly damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Ighv1-52 C A 12: 115,145,492 A115S probably benign Het
Igkv6-13 A G 6: 70,457,589 S91P probably damaging Het
Ints8 T A 4: 11,204,537 E973V possibly damaging Het
Itga3 T C 11: 95,051,462 K972R probably benign Het
Klhl33 A T 14: 50,893,021 F339I probably benign Het
Krt79 T C 15: 101,937,872 M214V probably benign Het
Lgsn A T 1: 31,204,193 H452L probably benign Het
Limd2 C T 11: 106,158,690 G124D probably benign Het
Luzp1 T C 4: 136,543,444 S993P probably damaging Het
Maml2 C T 9: 13,621,185 probably benign Het
Mbtd1 A T 11: 93,924,612 H342L probably damaging Het
Mfhas1 C A 8: 35,591,356 P995Q probably damaging Het
Muc5ac T C 7: 141,818,714 F3399S possibly damaging Het
Napb T C 2: 148,700,425 Y205C probably damaging Het
Odf2 G T 2: 29,912,617 A298S probably benign Het
Olfr1082 A T 2: 86,594,144 M228K probably damaging Het
Olfr1193 A T 2: 88,678,508 I218F probably benign Het
Olfr740 A T 14: 50,453,433 Y127F probably benign Het
Pcsk5 T C 19: 17,473,112 D1124G probably benign Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pik3c2b T G 1: 133,102,372 I1457S probably benign Het
Pole2 T C 12: 69,213,906 T167A possibly damaging Het
Rfx7 T A 9: 72,618,505 S992R probably damaging Het
Ryr2 G T 13: 11,712,166 S2436R probably damaging Het
Sgo2a A G 1: 58,016,640 D661G probably damaging Het
Sh3glb2 T A 2: 30,355,321 T49S probably damaging Het
Slc16a10 T C 10: 40,056,503 K354R possibly damaging Het
Slc6a6 C A 6: 91,752,438 T568K probably benign Het
Sptbn1 T C 11: 30,100,633 T2319A probably damaging Het
Tbl1xr1 T A 3: 22,179,290 Y15N probably damaging Het
Thyn1 T C 9: 27,006,442 S160P probably damaging Het
Tshz1 A T 18: 84,015,841 D147E probably benign Het
Vmn2r50 T G 7: 10,037,757 R672S probably benign Het
Zfp663 A T 2: 165,354,002 I99N possibly damaging Het
Other mutations in Card14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01916:Card14 APN 11 119343145 missense probably benign 0.10
IGL02070:Card14 APN 11 119344704 missense probably damaging 1.00
IGL02632:Card14 APN 11 119338904 missense probably benign 0.02
R0183:Card14 UTSW 11 119326698 missense probably damaging 1.00
R0614:Card14 UTSW 11 119322827 missense probably benign
R0766:Card14 UTSW 11 119324176 missense probably damaging 1.00
R1033:Card14 UTSW 11 119338370 missense probably damaging 1.00
R1705:Card14 UTSW 11 119338406 missense possibly damaging 0.77
R1907:Card14 UTSW 11 119331259 missense probably benign 0.00
R1992:Card14 UTSW 11 119321821 critical splice acceptor site probably null
R3729:Card14 UTSW 11 119333932 missense probably damaging 1.00
R4472:Card14 UTSW 11 119333958 missense possibly damaging 0.77
R4578:Card14 UTSW 11 119326741 missense probably benign 0.20
R4763:Card14 UTSW 11 119343175 missense probably damaging 0.99
R5117:Card14 UTSW 11 119338250 missense probably damaging 0.99
R5386:Card14 UTSW 11 119317289 missense probably damaging 1.00
R6457:Card14 UTSW 11 119339602 nonsense probably null
R6622:Card14 UTSW 11 119333988 missense probably benign 0.06
R7269:Card14 UTSW 11 119337747 missense probably damaging 1.00
R7304:Card14 UTSW 11 119337747 missense probably damaging 1.00
R7310:Card14 UTSW 11 119326179 missense probably null 1.00
R7612:Card14 UTSW 11 119333579 missense possibly damaging 0.52
R7689:Card14 UTSW 11 119325502 missense possibly damaging 0.66
R8181:Card14 UTSW 11 119321892 missense probably damaging 1.00
R8188:Card14 UTSW 11 119337797 missense probably damaging 1.00
R8493:Card14 UTSW 11 119333609 critical splice donor site probably null
R8499:Card14 UTSW 11 119331244 missense probably benign 0.10
R8924:Card14 UTSW 11 119326104 missense not run
Z1177:Card14 UTSW 11 119341061 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGACATCCAAGCTGACCGAG -3'
(R):5'- ACTCTCCAGCCAGATCATGC -3'

Sequencing Primer
(F):5'- ATCCAAGCTGACCGAGTGTCTG -3'
(R):5'- AGATCATGCTGGCCTCTTTTC -3'
Posted On2019-05-13