Incidental Mutation 'R6998:Ccdc88c'
ID544362
Institutional Source Beutler Lab
Gene Symbol Ccdc88c
Ensembl Gene ENSMUSG00000021182
Gene Namecoiled-coil domain containing 88C
Synonyms0610010D24Rik, Daple
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6998 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location100911523-101029056 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100916852 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 1587 (H1587R)
Ref Sequence ENSEMBL: ENSMUSP00000068629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068411] [ENSMUST00000085096]
Predicted Effect probably damaging
Transcript: ENSMUST00000068411
AA Change: H1587R

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000068629
Gene: ENSMUSG00000021182
AA Change: H1587R

DomainStartEndE-ValueType
Pfam:HOOK 7 586 5.9e-37 PFAM
low complexity region 601 613 N/A INTRINSIC
low complexity region 617 634 N/A INTRINSIC
Blast:BRLZ 668 719 3e-8 BLAST
low complexity region 724 744 N/A INTRINSIC
low complexity region 827 837 N/A INTRINSIC
low complexity region 847 866 N/A INTRINSIC
Blast:BRLZ 948 1007 6e-15 BLAST
coiled coil region 1035 1085 N/A INTRINSIC
low complexity region 1095 1110 N/A INTRINSIC
coiled coil region 1129 1252 N/A INTRINSIC
coiled coil region 1312 1384 N/A INTRINSIC
low complexity region 1430 1439 N/A INTRINSIC
low complexity region 1510 1524 N/A INTRINSIC
low complexity region 1562 1583 N/A INTRINSIC
low complexity region 1698 1709 N/A INTRINSIC
internal_repeat_1 1721 1778 6.97e-6 PROSPERO
low complexity region 1788 1808 N/A INTRINSIC
internal_repeat_1 1934 1989 6.97e-6 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000085096
AA Change: H1594R

PolyPhen 2 Score 0.748 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000082177
Gene: ENSMUSG00000021182
AA Change: H1594R

DomainStartEndE-ValueType
Pfam:HOOK 13 597 2.5e-41 PFAM
low complexity region 608 620 N/A INTRINSIC
low complexity region 624 641 N/A INTRINSIC
Blast:BRLZ 675 726 3e-8 BLAST
low complexity region 731 751 N/A INTRINSIC
low complexity region 834 844 N/A INTRINSIC
low complexity region 854 873 N/A INTRINSIC
Blast:BRLZ 955 1014 5e-15 BLAST
coiled coil region 1042 1092 N/A INTRINSIC
low complexity region 1102 1117 N/A INTRINSIC
coiled coil region 1136 1259 N/A INTRINSIC
coiled coil region 1319 1391 N/A INTRINSIC
low complexity region 1437 1446 N/A INTRINSIC
low complexity region 1517 1531 N/A INTRINSIC
low complexity region 1569 1590 N/A INTRINSIC
low complexity region 1705 1716 N/A INTRINSIC
internal_repeat_1 1728 1785 6.57e-6 PROSPERO
low complexity region 1795 1815 N/A INTRINSIC
internal_repeat_1 1941 1996 6.57e-6 PROSPERO
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitously expressed coiled-coil domain-containing protein that interacts with the dishevelled protein and is a negative regulator of the Wnt signalling pathway. The protein encoded by this gene has a PDZ-domain binding motif in its C-terminus with which it interacts with the dishevelled protein. Dishevelled is a scaffold protein involved in the regulation of the Wnt signaling pathway. The Wnt signaling pathway plays an important role in embryonic development, tissue maintenance, and cancer progression. Mutations in this gene cause autosomal recessive, primary non-syndromic congenital hydrocephalus; a condition characterized by excessive accumulation of cerebrospinal fluid in the ventricles of the brain. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam30 A G 3: 98,162,710 R620G probably benign Het
Adcy1 A C 11: 7,079,026 N259H probably damaging Het
Ahctf1 G A 1: 179,770,915 R2* probably null Het
Akr1c21 A G 13: 4,583,851 I306M probably benign Het
Alg9 T A 9: 50,789,621 S230R possibly damaging Het
Armt1 T A 10: 4,453,937 C341S probably benign Het
Aspg T A 12: 112,112,194 L29M probably damaging Het
Aspm C T 1: 139,469,472 T934I probably damaging Het
C1rl T C 6: 124,508,902 S411P probably damaging Het
Card14 A G 11: 119,322,899 E224G probably damaging Het
Ccp110 A G 7: 118,732,897 T963A possibly damaging Het
Cdk11b G A 4: 155,648,343 W546* probably null Het
Cyp8b1 T C 9: 121,915,993 N91S probably benign Het
Dab2 G T 15: 6,424,649 M213I possibly damaging Het
Decr1 A G 4: 15,930,960 V124A probably damaging Het
Fbxl13 T A 5: 21,543,689 I411F probably damaging Het
Fbxl13 T C 5: 21,620,613 I164V probably null Het
Fndc7 G A 3: 108,876,648 A215V probably benign Het
Garem2 T C 5: 30,114,170 M210T possibly damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Ighv1-52 C A 12: 115,145,492 A115S probably benign Het
Igkv6-13 A G 6: 70,457,589 S91P probably damaging Het
Ints8 T A 4: 11,204,537 E973V possibly damaging Het
Itga3 T C 11: 95,051,462 K972R probably benign Het
Klhl33 A T 14: 50,893,021 F339I probably benign Het
Krt79 T C 15: 101,937,872 M214V probably benign Het
Lgsn A T 1: 31,204,193 H452L probably benign Het
Limd2 C T 11: 106,158,690 G124D probably benign Het
Luzp1 T C 4: 136,543,444 S993P probably damaging Het
Maml2 C T 9: 13,621,185 probably benign Het
Mbtd1 A T 11: 93,924,612 H342L probably damaging Het
Mfhas1 C A 8: 35,591,356 P995Q probably damaging Het
Muc5ac T C 7: 141,818,714 F3399S possibly damaging Het
Napb T C 2: 148,700,425 Y205C probably damaging Het
Odf2 G T 2: 29,912,617 A298S probably benign Het
Olfr1082 A T 2: 86,594,144 M228K probably damaging Het
Olfr1193 A T 2: 88,678,508 I218F probably benign Het
Olfr740 A T 14: 50,453,433 Y127F probably benign Het
Pcsk5 T C 19: 17,473,112 D1124G probably benign Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pik3c2b T G 1: 133,102,372 I1457S probably benign Het
Pole2 T C 12: 69,213,906 T167A possibly damaging Het
Rfx7 T A 9: 72,618,505 S992R probably damaging Het
Ryr2 G T 13: 11,712,166 S2436R probably damaging Het
Sgo2a A G 1: 58,016,640 D661G probably damaging Het
Sh3glb2 T A 2: 30,355,321 T49S probably damaging Het
Slc16a10 T C 10: 40,056,503 K354R possibly damaging Het
Slc6a6 C A 6: 91,752,438 T568K probably benign Het
Sptbn1 T C 11: 30,100,633 T2319A probably damaging Het
Tbl1xr1 T A 3: 22,179,290 Y15N probably damaging Het
Thyn1 T C 9: 27,006,442 S160P probably damaging Het
Tshz1 A T 18: 84,015,841 D147E probably benign Het
Vmn2r50 T G 7: 10,037,757 R672S probably benign Het
Zfp663 A T 2: 165,354,002 I99N possibly damaging Het
Other mutations in Ccdc88c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01112:Ccdc88c APN 12 100916803 missense probably benign 0.04
IGL02016:Ccdc88c APN 12 100941207 missense possibly damaging 0.63
IGL02031:Ccdc88c APN 12 100933311 missense probably damaging 0.98
IGL02133:Ccdc88c APN 12 100940090 missense probably damaging 1.00
IGL02427:Ccdc88c APN 12 100921592 missense probably damaging 1.00
IGL02494:Ccdc88c APN 12 100945475 missense probably benign
IGL02496:Ccdc88c APN 12 100953293 missense probably benign 0.05
IGL02549:Ccdc88c APN 12 100928932 missense probably benign 0.18
IGL02618:Ccdc88c APN 12 100913553 missense probably benign 0.28
IGL02626:Ccdc88c APN 12 100967800 unclassified probably benign
IGL03142:Ccdc88c APN 12 100947198 missense probably damaging 1.00
BB010:Ccdc88c UTSW 12 100945490 missense possibly damaging 0.93
BB020:Ccdc88c UTSW 12 100945490 missense possibly damaging 0.93
R0127:Ccdc88c UTSW 12 100935740 missense possibly damaging 0.88
R0533:Ccdc88c UTSW 12 100954282 missense probably damaging 1.00
R0545:Ccdc88c UTSW 12 100947188 missense probably damaging 1.00
R0866:Ccdc88c UTSW 12 100913192 missense probably benign 0.01
R1230:Ccdc88c UTSW 12 100948488 missense probably benign 0.00
R1434:Ccdc88c UTSW 12 100939166 splice site probably benign
R1614:Ccdc88c UTSW 12 100912984 missense probably benign 0.00
R1644:Ccdc88c UTSW 12 100913474 missense probably damaging 0.98
R1712:Ccdc88c UTSW 12 100939025 missense probably benign 0.14
R2107:Ccdc88c UTSW 12 100921549 missense probably benign
R3612:Ccdc88c UTSW 12 100939073 missense probably damaging 0.99
R3724:Ccdc88c UTSW 12 100930524 missense possibly damaging 0.80
R3737:Ccdc88c UTSW 12 100930524 missense possibly damaging 0.80
R3743:Ccdc88c UTSW 12 100948584 missense probably damaging 1.00
R3772:Ccdc88c UTSW 12 100966100 unclassified probably benign
R3776:Ccdc88c UTSW 12 100947179 missense probably damaging 0.97
R3917:Ccdc88c UTSW 12 100941107 critical splice donor site probably null
R4034:Ccdc88c UTSW 12 100930524 missense possibly damaging 0.80
R4035:Ccdc88c UTSW 12 100930524 missense possibly damaging 0.80
R4110:Ccdc88c UTSW 12 100945073 missense probably damaging 1.00
R4113:Ccdc88c UTSW 12 100945073 missense probably damaging 1.00
R4270:Ccdc88c UTSW 12 100947219 missense probably damaging 1.00
R4271:Ccdc88c UTSW 12 100947219 missense probably damaging 1.00
R4520:Ccdc88c UTSW 12 100913332 missense possibly damaging 0.48
R4521:Ccdc88c UTSW 12 100913332 missense possibly damaging 0.48
R4522:Ccdc88c UTSW 12 100913332 missense possibly damaging 0.48
R4523:Ccdc88c UTSW 12 100913332 missense possibly damaging 0.48
R4524:Ccdc88c UTSW 12 100913332 missense possibly damaging 0.48
R4717:Ccdc88c UTSW 12 100916666 missense probably benign 0.00
R4821:Ccdc88c UTSW 12 100938079 missense probably benign 0.00
R4823:Ccdc88c UTSW 12 100930543 missense probably damaging 1.00
R5090:Ccdc88c UTSW 12 100954180 missense probably damaging 1.00
R5510:Ccdc88c UTSW 12 100945031 missense probably damaging 1.00
R5514:Ccdc88c UTSW 12 100913439 missense probably damaging 1.00
R5903:Ccdc88c UTSW 12 100930542 missense probably damaging 1.00
R5999:Ccdc88c UTSW 12 100968354 missense probably damaging 1.00
R6131:Ccdc88c UTSW 12 100941128 missense probably damaging 1.00
R6164:Ccdc88c UTSW 12 100953383 missense probably damaging 0.98
R6971:Ccdc88c UTSW 12 100954227 missense probably damaging 1.00
R7031:Ccdc88c UTSW 12 100945064 missense probably damaging 1.00
R7240:Ccdc88c UTSW 12 100944939 missense probably benign 0.17
R7366:Ccdc88c UTSW 12 100944950 missense possibly damaging 0.89
R7604:Ccdc88c UTSW 12 100930547 missense probably damaging 1.00
R7674:Ccdc88c UTSW 12 100945232 missense probably benign 0.00
R7795:Ccdc88c UTSW 12 100923311 missense probably benign 0.32
R7933:Ccdc88c UTSW 12 100945490 missense possibly damaging 0.93
R7990:Ccdc88c UTSW 12 100967985 missense probably damaging 1.00
R8339:Ccdc88c UTSW 12 100941140 nonsense probably null
R8734:Ccdc88c UTSW 12 100940135 missense probably damaging 1.00
R8778:Ccdc88c UTSW 12 100945224 missense probably benign 0.25
Z1176:Ccdc88c UTSW 12 100945770 missense possibly damaging 0.69
Z1177:Ccdc88c UTSW 12 100945155 missense probably benign
Z1190:Ccdc88c UTSW 12 100923332 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCGCCCTTCTTCTGGATAG -3'
(R):5'- AATACTGCCTGCTACCTAGGAG -3'

Sequencing Primer
(F):5'- CTTCTGGATAGTCTCCTGGGAG -3'
(R):5'- CCTGCTACCTAGGAGATGGG -3'
Posted On2019-05-13