Incidental Mutation 'R6998:Akr1c21'
ID544365
Institutional Source Beutler Lab
Gene Symbol Akr1c21
Ensembl Gene ENSMUSG00000021207
Gene Namealdo-keto reductase family 1, member C21
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R6998 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location4574075-4586541 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4583851 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 306 (I306M)
Ref Sequence ENSEMBL: ENSMUSP00000021628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021628] [ENSMUST00000223285]
PDB Structure
Crystal structure of 17alpha-hydroxysteroid dehydrogenase in binary complex with NADP(H) in an open conformation [X-RAY DIFFRACTION]
Crystal structure of 17alpha-hydroxysteroid dehydrogenase in its apo-form [X-RAY DIFFRACTION]
Crystal structure of 17alpha-hydroxysteroid dehydrogenase in complex with NADP(H) in a closed conformation [X-RAY DIFFRACTION]
Crystal structure of 17alpha-hydroxysteroid dehydrogenase in complex with NADP+ and epi-testosterone [X-RAY DIFFRACTION]
Crystal structure of 17alpha-hydroxysteroid dehydrogenase mutant K31A in complex with NADP+ and epi-testosterone [X-RAY DIFFRACTION]
Crystal structure of mouse 17-alpha hydroxysteroid dehydrogenase in complex with coenzyme NADPH [X-RAY DIFFRACTION]
The crystal structure of mouse 17-alpha hydroxysteroid dehydrogenase GG225.226PP mutant in complex with inhibitor and cofactor NADP+. [X-RAY DIFFRACTION]
The crystal structure of 17-alpha hydroxysteroid dehydrogenase Y224D mutant. [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000021628
AA Change: I306M

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000021628
Gene: ENSMUSG00000021207
AA Change: I306M

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 18 301 2.2e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223285
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam30 A G 3: 98,162,710 R620G probably benign Het
Adcy1 A C 11: 7,079,026 N259H probably damaging Het
Ahctf1 G A 1: 179,770,915 R2* probably null Het
Alg9 T A 9: 50,789,621 S230R possibly damaging Het
Armt1 T A 10: 4,453,937 C341S probably benign Het
Aspg T A 12: 112,112,194 L29M probably damaging Het
Aspm C T 1: 139,469,472 T934I probably damaging Het
C1rl T C 6: 124,508,902 S411P probably damaging Het
Card14 A G 11: 119,322,899 E224G probably damaging Het
Ccdc88c T C 12: 100,916,852 H1587R probably damaging Het
Ccp110 A G 7: 118,732,897 T963A possibly damaging Het
Cdk11b G A 4: 155,648,343 W546* probably null Het
Cyp8b1 T C 9: 121,915,993 N91S probably benign Het
Dab2 G T 15: 6,424,649 M213I possibly damaging Het
Decr1 A G 4: 15,930,960 V124A probably damaging Het
Fbxl13 T A 5: 21,543,689 I411F probably damaging Het
Fbxl13 T C 5: 21,620,613 I164V probably null Het
Fndc7 G A 3: 108,876,648 A215V probably benign Het
Garem2 T C 5: 30,114,170 M210T possibly damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Ighv1-52 C A 12: 115,145,492 A115S probably benign Het
Igkv6-13 A G 6: 70,457,589 S91P probably damaging Het
Ints8 T A 4: 11,204,537 E973V possibly damaging Het
Itga3 T C 11: 95,051,462 K972R probably benign Het
Klhl33 A T 14: 50,893,021 F339I probably benign Het
Krt79 T C 15: 101,937,872 M214V probably benign Het
Lgsn A T 1: 31,204,193 H452L probably benign Het
Limd2 C T 11: 106,158,690 G124D probably benign Het
Luzp1 T C 4: 136,543,444 S993P probably damaging Het
Maml2 C T 9: 13,621,185 probably benign Het
Mbtd1 A T 11: 93,924,612 H342L probably damaging Het
Mfhas1 C A 8: 35,591,356 P995Q probably damaging Het
Muc5ac T C 7: 141,818,714 F3399S possibly damaging Het
Napb T C 2: 148,700,425 Y205C probably damaging Het
Odf2 G T 2: 29,912,617 A298S probably benign Het
Olfr1082 A T 2: 86,594,144 M228K probably damaging Het
Olfr1193 A T 2: 88,678,508 I218F probably benign Het
Olfr740 A T 14: 50,453,433 Y127F probably benign Het
Pcsk5 T C 19: 17,473,112 D1124G probably benign Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pik3c2b T G 1: 133,102,372 I1457S probably benign Het
Pole2 T C 12: 69,213,906 T167A possibly damaging Het
Rfx7 T A 9: 72,618,505 S992R probably damaging Het
Ryr2 G T 13: 11,712,166 S2436R probably damaging Het
Sgo2a A G 1: 58,016,640 D661G probably damaging Het
Sh3glb2 T A 2: 30,355,321 T49S probably damaging Het
Slc16a10 T C 10: 40,056,503 K354R possibly damaging Het
Slc6a6 C A 6: 91,752,438 T568K probably benign Het
Sptbn1 T C 11: 30,100,633 T2319A probably damaging Het
Tbl1xr1 T A 3: 22,179,290 Y15N probably damaging Het
Thyn1 T C 9: 27,006,442 S160P probably damaging Het
Tshz1 A T 18: 84,015,841 D147E probably benign Het
Vmn2r50 T G 7: 10,037,757 R672S probably benign Het
Zfp663 A T 2: 165,354,002 I99N possibly damaging Het
Other mutations in Akr1c21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00645:Akr1c21 APN 13 4576313 missense probably damaging 1.00
IGL01093:Akr1c21 APN 13 4581140 splice site probably benign
IGL01408:Akr1c21 APN 13 4577432 missense probably benign
IGL02470:Akr1c21 APN 13 4577407 missense probably damaging 1.00
IGL02683:Akr1c21 APN 13 4576313 missense probably damaging 1.00
IGL02738:Akr1c21 APN 13 4580301 missense probably damaging 1.00
IGL03126:Akr1c21 APN 13 4577458 missense possibly damaging 0.76
IGL03365:Akr1c21 APN 13 4583852 missense probably benign 0.00
R0166:Akr1c21 UTSW 13 4581264 missense probably damaging 1.00
R0391:Akr1c21 UTSW 13 4581200 missense probably damaging 1.00
R0505:Akr1c21 UTSW 13 4576307 missense probably damaging 1.00
R1069:Akr1c21 UTSW 13 4575334 splice site probably benign
R1168:Akr1c21 UTSW 13 4583837 missense probably benign 0.04
R1617:Akr1c21 UTSW 13 4576352 splice site probably null
R1686:Akr1c21 UTSW 13 4577453 missense probably damaging 1.00
R1694:Akr1c21 UTSW 13 4575178 missense probably damaging 0.98
R1753:Akr1c21 UTSW 13 4577135 nonsense probably null
R1977:Akr1c21 UTSW 13 4574212 missense probably damaging 1.00
R2005:Akr1c21 UTSW 13 4574215 missense probably damaging 1.00
R2036:Akr1c21 UTSW 13 4576306 missense probably damaging 0.98
R2198:Akr1c21 UTSW 13 4577465 missense probably damaging 1.00
R2925:Akr1c21 UTSW 13 4576350 splice site probably null
R4965:Akr1c21 UTSW 13 4580305 missense probably damaging 1.00
R6245:Akr1c21 UTSW 13 4575232 missense possibly damaging 0.93
R6381:Akr1c21 UTSW 13 4574184 missense probably damaging 1.00
R6711:Akr1c21 UTSW 13 4577375 missense probably damaging 1.00
R6843:Akr1c21 UTSW 13 4575214 missense probably damaging 1.00
R7253:Akr1c21 UTSW 13 4577140 missense probably damaging 1.00
R7475:Akr1c21 UTSW 13 4576319 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TGCCTCATCTGACCTCACAG -3'
(R):5'- CCCTGCTTCTGTGAATAAGGCC -3'

Sequencing Primer
(F):5'- GACCTCACAGGGGTTATTCTGTAC -3'
(R):5'- GCTTCTGTGAATAAGGCCAGAACTC -3'
Posted On2019-05-13