Incidental Mutation 'R6998:Olfr740'
ID544367
Institutional Source Beutler Lab
Gene Symbol Olfr740
Ensembl Gene ENSMUSG00000095917
Gene Nameolfactory receptor 740
SynonymsMOR106-4, GA_x6K02T2PMLR-6167145-6168080
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R6998 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location50445545-50456933 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 50453433 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 127 (Y127F)
Ref Sequence ENSEMBL: ENSMUSP00000148916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089838] [ENSMUST00000214792]
Predicted Effect probably benign
Transcript: ENSMUST00000089838
AA Change: Y127F

PolyPhen 2 Score 0.292 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000087276
Gene: ENSMUSG00000095917
AA Change: Y127F

DomainStartEndE-ValueType
Pfam:7tm_4 35 311 2.3e-56 PFAM
Pfam:7tm_1 45 294 1.6e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214792
AA Change: Y127F

PolyPhen 2 Score 0.292 (Sensitivity: 0.91; Specificity: 0.89)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam30 A G 3: 98,162,710 R620G probably benign Het
Adcy1 A C 11: 7,079,026 N259H probably damaging Het
Ahctf1 G A 1: 179,770,915 R2* probably null Het
Akr1c21 A G 13: 4,583,851 I306M probably benign Het
Alg9 T A 9: 50,789,621 S230R possibly damaging Het
Armt1 T A 10: 4,453,937 C341S probably benign Het
Aspg T A 12: 112,112,194 L29M probably damaging Het
Aspm C T 1: 139,469,472 T934I probably damaging Het
C1rl T C 6: 124,508,902 S411P probably damaging Het
Card14 A G 11: 119,322,899 E224G probably damaging Het
Ccdc88c T C 12: 100,916,852 H1587R probably damaging Het
Ccp110 A G 7: 118,732,897 T963A possibly damaging Het
Cdk11b G A 4: 155,648,343 W546* probably null Het
Cyp8b1 T C 9: 121,915,993 N91S probably benign Het
Dab2 G T 15: 6,424,649 M213I possibly damaging Het
Decr1 A G 4: 15,930,960 V124A probably damaging Het
Fbxl13 T A 5: 21,543,689 I411F probably damaging Het
Fbxl13 T C 5: 21,620,613 I164V probably null Het
Fndc7 G A 3: 108,876,648 A215V probably benign Het
Garem2 T C 5: 30,114,170 M210T possibly damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Ighv1-52 C A 12: 115,145,492 A115S probably benign Het
Igkv6-13 A G 6: 70,457,589 S91P probably damaging Het
Ints8 T A 4: 11,204,537 E973V possibly damaging Het
Itga3 T C 11: 95,051,462 K972R probably benign Het
Klhl33 A T 14: 50,893,021 F339I probably benign Het
Krt79 T C 15: 101,937,872 M214V probably benign Het
Lgsn A T 1: 31,204,193 H452L probably benign Het
Limd2 C T 11: 106,158,690 G124D probably benign Het
Luzp1 T C 4: 136,543,444 S993P probably damaging Het
Maml2 C T 9: 13,621,185 probably benign Het
Mbtd1 A T 11: 93,924,612 H342L probably damaging Het
Mfhas1 C A 8: 35,591,356 P995Q probably damaging Het
Muc5ac T C 7: 141,818,714 F3399S possibly damaging Het
Napb T C 2: 148,700,425 Y205C probably damaging Het
Odf2 G T 2: 29,912,617 A298S probably benign Het
Olfr1082 A T 2: 86,594,144 M228K probably damaging Het
Olfr1193 A T 2: 88,678,508 I218F probably benign Het
Pcsk5 T C 19: 17,473,112 D1124G probably benign Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pik3c2b T G 1: 133,102,372 I1457S probably benign Het
Pole2 T C 12: 69,213,906 T167A possibly damaging Het
Rfx7 T A 9: 72,618,505 S992R probably damaging Het
Ryr2 G T 13: 11,712,166 S2436R probably damaging Het
Sgo2a A G 1: 58,016,640 D661G probably damaging Het
Sh3glb2 T A 2: 30,355,321 T49S probably damaging Het
Slc16a10 T C 10: 40,056,503 K354R possibly damaging Het
Slc6a6 C A 6: 91,752,438 T568K probably benign Het
Sptbn1 T C 11: 30,100,633 T2319A probably damaging Het
Tbl1xr1 T A 3: 22,179,290 Y15N probably damaging Het
Thyn1 T C 9: 27,006,442 S160P probably damaging Het
Tshz1 A T 18: 84,015,841 D147E probably benign Het
Vmn2r50 T G 7: 10,037,757 R672S probably benign Het
Zfp663 A T 2: 165,354,002 I99N possibly damaging Het
Other mutations in Olfr740
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01663:Olfr740 APN 14 50453150 missense probably benign 0.04
IGL02117:Olfr740 APN 14 50453942 missense possibly damaging 0.91
IGL02663:Olfr740 APN 14 50453852 missense probably benign 0.02
IGL02858:Olfr740 APN 14 50453050 utr 5 prime probably benign
IGL02955:Olfr740 APN 14 50453985 missense probably damaging 0.99
IGL03210:Olfr740 APN 14 50453983 missense probably benign 0.10
IGL03249:Olfr740 APN 14 50453211 missense probably damaging 0.98
R0946:Olfr740 UTSW 14 50453673 missense probably benign 0.13
R1449:Olfr740 UTSW 14 50453921 missense probably damaging 1.00
R1465:Olfr740 UTSW 14 50453177 missense possibly damaging 0.91
R1465:Olfr740 UTSW 14 50453177 missense possibly damaging 0.91
R1513:Olfr740 UTSW 14 50453681 missense probably benign 0.00
R1908:Olfr740 UTSW 14 50453838 missense probably damaging 0.99
R2422:Olfr740 UTSW 14 50453436 missense probably damaging 1.00
R3406:Olfr740 UTSW 14 50453196 missense probably benign 0.14
R4184:Olfr740 UTSW 14 50453370 missense probably damaging 1.00
R4795:Olfr740 UTSW 14 50453417 missense probably damaging 0.96
R5028:Olfr740 UTSW 14 50453739 missense probably damaging 1.00
R5436:Olfr740 UTSW 14 50453727 missense probably damaging 1.00
R6057:Olfr740 UTSW 14 50453744 nonsense probably null
R6455:Olfr740 UTSW 14 50453585 missense possibly damaging 0.92
R6903:Olfr740 UTSW 14 50453955 missense possibly damaging 0.93
R7671:Olfr740 UTSW 14 50453885 missense probably benign 0.04
R8048:Olfr740 UTSW 14 50453916 missense possibly damaging 0.52
X0066:Olfr740 UTSW 14 50453658 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCCATGTACCTACTGCTGG -3'
(R):5'- CCATTAATGGGGCTCTGGAAC -3'

Sequencing Primer
(F):5'- ATGTACCTACTGCTGGCCAAC -3'
(R):5'- CAATAGAGGGCCTGGGTCACAC -3'
Posted On2019-05-13