Incidental Mutation 'R6998:Dab2'
ID 544369
Institutional Source Beutler Lab
Gene Symbol Dab2
Ensembl Gene ENSMUSG00000022150
Gene Name disabled 2, mitogen-responsive phosphoprotein
Synonyms 5730435J12Rik, D15Wsu122e, D630005B22Rik, p96
MMRRC Submission 045010-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.914) question?
Stock # R6998 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 6329269-6470193 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 6454130 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 213 (M213I)
Ref Sequence ENSEMBL: ENSMUSP00000079689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078019] [ENSMUST00000080880] [ENSMUST00000110663] [ENSMUST00000110664] [ENSMUST00000160134] [ENSMUST00000161040] [ENSMUST00000161812] [ENSMUST00000162094]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000078019
AA Change: M213I

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000077166
Gene: ENSMUSG00000022150
AA Change: M213I

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PTB 45 179 1.16e-27 SMART
low complexity region 270 288 N/A INTRINSIC
low complexity region 292 306 N/A INTRINSIC
low complexity region 335 355 N/A INTRINSIC
low complexity region 378 394 N/A INTRINSIC
PDB:3H8D|H 465 493 2e-12 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000080880
AA Change: M213I

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000079689
Gene: ENSMUSG00000022150
AA Change: M213I

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PTB 45 179 1.16e-27 SMART
low complexity region 488 506 N/A INTRINSIC
low complexity region 510 524 N/A INTRINSIC
low complexity region 553 573 N/A INTRINSIC
low complexity region 596 612 N/A INTRINSIC
PDB:3H8D|H 683 711 3e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000110663
AA Change: M213I

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000106291
Gene: ENSMUSG00000022150
AA Change: M213I

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PTB 45 179 1.16e-27 SMART
low complexity region 270 288 N/A INTRINSIC
low complexity region 292 306 N/A INTRINSIC
low complexity region 335 355 N/A INTRINSIC
low complexity region 378 394 N/A INTRINSIC
PDB:3H8D|H 465 493 2e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000110664
SMART Domains Protein: ENSMUSP00000106292
Gene: ENSMUSG00000022150

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PTB 45 179 1.16e-27 SMART
low complexity region 467 485 N/A INTRINSIC
low complexity region 489 503 N/A INTRINSIC
low complexity region 532 552 N/A INTRINSIC
low complexity region 575 591 N/A INTRINSIC
PDB:3H8D|H 662 690 3e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000160134
AA Change: M213I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125021
Gene: ENSMUSG00000022150
AA Change: M213I

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PTB 45 179 1.16e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161040
AA Change: M213I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124478
Gene: ENSMUSG00000022150
AA Change: M213I

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PTB 45 179 1.16e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161812
SMART Domains Protein: ENSMUSP00000124589
Gene: ENSMUSG00000022150

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PTB 45 179 1.16e-27 SMART
low complexity region 249 267 N/A INTRINSIC
low complexity region 271 285 N/A INTRINSIC
low complexity region 314 334 N/A INTRINSIC
low complexity region 357 373 N/A INTRINSIC
PDB:3H8D|H 444 472 2e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000162094
SMART Domains Protein: ENSMUSP00000125696
Gene: ENSMUSG00000022150

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
Pfam:PID 50 110 2.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163082
SMART Domains Protein: ENSMUSP00000124996
Gene: ENSMUSG00000022150

DomainStartEndE-ValueType
Blast:PTB 2 59 1e-33 BLAST
PDB:1P3R|C 2 59 2e-34 PDB
SCOP:d1ddma_ 3 59 9e-12 SMART
low complexity region 60 79 N/A INTRINSIC
low complexity region 356 374 N/A INTRINSIC
low complexity region 378 392 N/A INTRINSIC
low complexity region 421 441 N/A INTRINSIC
low complexity region 464 480 N/A INTRINSIC
PDB:3H8D|H 551 579 3e-12 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitogen-responsive phosphoprotein. It is expressed in normal ovarian epithelial cells, but is down-regulated or absent from ovarian carcinoma cell lines, suggesting its role as a tumor suppressor. This protein binds to the SH3 domains of GRB2, an adaptor protein that couples tyrosine kinase receptors to SOS (a guanine nucleotide exchange factor for Ras), via its C-terminal proline-rich sequences, and may thus modulate growth factor/Ras pathways by competing with SOS for binding to GRB2. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mutants exhibit abnormal primitive endoderm structure and/or function, lack a proamniotic cavity and die prior to embryonic day 9.5. A conditional mutant survives, but shows kidney proximal tubule abnormality. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam30 A G 3: 98,070,026 (GRCm39) R620G probably benign Het
Adcy1 A C 11: 7,029,026 (GRCm39) N259H probably damaging Het
Ahctf1 G A 1: 179,598,480 (GRCm39) R2* probably null Het
Akr1c21 A G 13: 4,633,850 (GRCm39) I306M probably benign Het
Alg9 T A 9: 50,700,921 (GRCm39) S230R possibly damaging Het
Armt1 T A 10: 4,403,937 (GRCm39) C341S probably benign Het
Aspg T A 12: 112,078,628 (GRCm39) L29M probably damaging Het
Aspm C T 1: 139,397,210 (GRCm39) T934I probably damaging Het
C1rl T C 6: 124,485,861 (GRCm39) S411P probably damaging Het
Card14 A G 11: 119,213,725 (GRCm39) E224G probably damaging Het
Ccdc88c T C 12: 100,883,111 (GRCm39) H1587R probably damaging Het
Ccp110 A G 7: 118,332,120 (GRCm39) T963A possibly damaging Het
Cdk11b G A 4: 155,732,800 (GRCm39) W546* probably null Het
Cyp8b1 T C 9: 121,745,059 (GRCm39) N91S probably benign Het
Decr1 A G 4: 15,930,960 (GRCm39) V124A probably damaging Het
Fbxl13 T A 5: 21,748,687 (GRCm39) I411F probably damaging Het
Fbxl13 T C 5: 21,825,611 (GRCm39) I164V probably null Het
Fndc7 G A 3: 108,783,964 (GRCm39) A215V probably benign Het
Garem2 T C 5: 30,319,168 (GRCm39) M210T possibly damaging Het
Gpatch2l G A 12: 86,290,958 (GRCm39) R47H probably damaging Het
Ighv1-52 C A 12: 115,109,112 (GRCm39) A115S probably benign Het
Igkv6-13 A G 6: 70,434,573 (GRCm39) S91P probably damaging Het
Ints8 T A 4: 11,204,537 (GRCm39) E973V possibly damaging Het
Itga3 T C 11: 94,942,288 (GRCm39) K972R probably benign Het
Klhl33 A T 14: 51,130,478 (GRCm39) F339I probably benign Het
Krt79 T C 15: 101,846,307 (GRCm39) M214V probably benign Het
Lgsn A T 1: 31,243,274 (GRCm39) H452L probably benign Het
Limd2 C T 11: 106,049,516 (GRCm39) G124D probably benign Het
Luzp1 T C 4: 136,270,755 (GRCm39) S993P probably damaging Het
Maml2 C T 9: 13,532,481 (GRCm39) probably benign Het
Mbtd1 A T 11: 93,815,438 (GRCm39) H342L probably damaging Het
Mfhas1 C A 8: 36,058,510 (GRCm39) P995Q probably damaging Het
Muc5ac T C 7: 141,372,451 (GRCm39) F3399S possibly damaging Het
Napb T C 2: 148,542,345 (GRCm39) Y205C probably damaging Het
Odf2 G T 2: 29,802,629 (GRCm39) A298S probably benign Het
Or11g7 A T 14: 50,690,890 (GRCm39) Y127F probably benign Het
Or4s2b A T 2: 88,508,852 (GRCm39) I218F probably benign Het
Or8k35 A T 2: 86,424,488 (GRCm39) M228K probably damaging Het
Pcsk5 T C 19: 17,450,476 (GRCm39) D1124G probably benign Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 (GRCm39) probably benign Het
Pik3c2b T G 1: 133,030,110 (GRCm39) I1457S probably benign Het
Pole2 T C 12: 69,260,680 (GRCm39) T167A possibly damaging Het
Rfx7 T A 9: 72,525,787 (GRCm39) S992R probably damaging Het
Ryr2 G T 13: 11,727,052 (GRCm39) S2436R probably damaging Het
Sgo2a A G 1: 58,055,799 (GRCm39) D661G probably damaging Het
Sh3glb2 T A 2: 30,245,333 (GRCm39) T49S probably damaging Het
Slc16a10 T C 10: 39,932,499 (GRCm39) K354R possibly damaging Het
Slc6a6 C A 6: 91,729,419 (GRCm39) T568K probably benign Het
Sptbn1 T C 11: 30,050,633 (GRCm39) T2319A probably damaging Het
Tbl1xr1 T A 3: 22,233,454 (GRCm39) Y15N probably damaging Het
Thyn1 T C 9: 26,917,738 (GRCm39) S160P probably damaging Het
Tshz1 A T 18: 84,033,966 (GRCm39) D147E probably benign Het
Vmn2r50 T G 7: 9,771,684 (GRCm39) R672S probably benign Het
Zfp663 A T 2: 165,195,922 (GRCm39) I99N possibly damaging Het
Other mutations in Dab2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Dab2 APN 15 6,459,306 (GRCm39) missense probably benign 0.00
IGL00731:Dab2 APN 15 6,465,191 (GRCm39) missense possibly damaging 0.95
IGL02382:Dab2 APN 15 6,466,468 (GRCm39) missense possibly damaging 0.62
IGL02598:Dab2 APN 15 6,458,847 (GRCm39) missense probably damaging 0.97
IGL03054:Dab2 APN 15 6,447,707 (GRCm39) unclassified probably benign
IGL03093:Dab2 APN 15 6,465,892 (GRCm39) missense probably damaging 1.00
IGL03369:Dab2 APN 15 6,464,790 (GRCm39) missense possibly damaging 0.64
IGL03372:Dab2 APN 15 6,459,030 (GRCm39) missense probably damaging 0.99
R0157:Dab2 UTSW 15 6,459,308 (GRCm39) missense probably benign 0.00
R0326:Dab2 UTSW 15 6,447,797 (GRCm39) missense probably damaging 1.00
R0488:Dab2 UTSW 15 6,454,135 (GRCm39) missense probably damaging 1.00
R0552:Dab2 UTSW 15 6,464,895 (GRCm39) missense possibly damaging 0.65
R0938:Dab2 UTSW 15 6,464,865 (GRCm39) missense probably benign 0.04
R1433:Dab2 UTSW 15 6,459,419 (GRCm39) missense probably damaging 1.00
R1635:Dab2 UTSW 15 6,459,351 (GRCm39) missense possibly damaging 0.80
R1713:Dab2 UTSW 15 6,459,182 (GRCm39) missense possibly damaging 0.94
R1757:Dab2 UTSW 15 6,359,933 (GRCm39) intron probably benign
R1800:Dab2 UTSW 15 6,464,948 (GRCm39) missense probably benign
R1837:Dab2 UTSW 15 6,365,957 (GRCm39) intron probably benign
R1999:Dab2 UTSW 15 6,446,398 (GRCm39) missense probably benign 0.32
R2050:Dab2 UTSW 15 6,464,696 (GRCm39) missense possibly damaging 0.47
R2117:Dab2 UTSW 15 6,465,096 (GRCm39) missense probably damaging 1.00
R2129:Dab2 UTSW 15 6,365,864 (GRCm39) nonsense probably null
R2150:Dab2 UTSW 15 6,446,398 (GRCm39) missense probably benign 0.32
R2329:Dab2 UTSW 15 6,459,044 (GRCm39) missense possibly damaging 0.80
R2338:Dab2 UTSW 15 6,464,733 (GRCm39) missense possibly damaging 0.62
R2680:Dab2 UTSW 15 6,466,474 (GRCm39) missense possibly damaging 0.89
R3978:Dab2 UTSW 15 6,464,644 (GRCm39) critical splice acceptor site probably null
R3979:Dab2 UTSW 15 6,464,644 (GRCm39) critical splice acceptor site probably null
R3980:Dab2 UTSW 15 6,464,644 (GRCm39) critical splice acceptor site probably null
R4551:Dab2 UTSW 15 6,464,775 (GRCm39) missense probably damaging 0.97
R4795:Dab2 UTSW 15 6,459,092 (GRCm39) missense probably benign 0.16
R4829:Dab2 UTSW 15 6,454,162 (GRCm39) missense probably damaging 1.00
R4830:Dab2 UTSW 15 6,457,008 (GRCm39) missense probably benign
R4832:Dab2 UTSW 15 6,366,080 (GRCm39) splice site probably null
R5168:Dab2 UTSW 15 6,365,924 (GRCm39) intron probably benign
R5620:Dab2 UTSW 15 6,447,796 (GRCm39) missense probably damaging 0.98
R5996:Dab2 UTSW 15 6,464,792 (GRCm39) nonsense probably null
R6159:Dab2 UTSW 15 6,465,941 (GRCm39) missense possibly damaging 0.93
R7002:Dab2 UTSW 15 6,464,846 (GRCm39) missense probably benign 0.01
R7040:Dab2 UTSW 15 6,451,732 (GRCm39) missense probably damaging 1.00
R7138:Dab2 UTSW 15 6,458,780 (GRCm39) missense probably benign 0.24
R7448:Dab2 UTSW 15 6,451,747 (GRCm39) missense probably damaging 1.00
R7548:Dab2 UTSW 15 6,459,399 (GRCm39) missense possibly damaging 0.80
R8062:Dab2 UTSW 15 6,456,822 (GRCm39) missense probably damaging 0.99
R8124:Dab2 UTSW 15 6,458,878 (GRCm39) nonsense probably null
R8164:Dab2 UTSW 15 6,460,449 (GRCm39) missense possibly damaging 0.92
R8171:Dab2 UTSW 15 6,453,407 (GRCm39) missense probably benign 0.00
R8230:Dab2 UTSW 15 6,451,824 (GRCm39) missense probably damaging 1.00
R8372:Dab2 UTSW 15 6,446,406 (GRCm39) missense possibly damaging 0.80
R8427:Dab2 UTSW 15 6,458,840 (GRCm39) nonsense probably null
R8919:Dab2 UTSW 15 6,465,271 (GRCm39) missense
R9363:Dab2 UTSW 15 6,460,481 (GRCm39) missense probably benign 0.16
R9461:Dab2 UTSW 15 6,460,435 (GRCm39) missense possibly damaging 0.82
R9532:Dab2 UTSW 15 6,451,762 (GRCm39) missense probably damaging 1.00
R9779:Dab2 UTSW 15 6,460,525 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGGGAACAAGCCTACACTG -3'
(R):5'- AGGTTCCTATGGCCACTTAAG -3'

Sequencing Primer
(F):5'- TGACACAAGCAGCCTGATATC -3'
(R):5'- GCTCAAGCTCTCTGGTTAA -3'
Posted On 2019-05-13