Incidental Mutation 'R0608:Slc7a7'
ID 54437
Institutional Source Beutler Lab
Gene Symbol Slc7a7
Ensembl Gene ENSMUSG00000000958
Gene Name solute carrier family 7 (cationic amino acid transporter, y+ system), member 7
Synonyms my+lat1
MMRRC Submission 038797-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0608 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 54606899-54655237 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 54615259 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 246 (L246P)
Ref Sequence ENSEMBL: ENSMUSP00000154533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000984] [ENSMUST00000195970] [ENSMUST00000197440] [ENSMUST00000200545] [ENSMUST00000226753] [ENSMUST00000228488]
AlphaFold Q9Z1K8
Predicted Effect probably damaging
Transcript: ENSMUST00000000984
AA Change: L246P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000984
Gene: ENSMUSG00000000958
AA Change: L246P

DomainStartEndE-ValueType
Pfam:AA_permease_2 38 463 2e-64 PFAM
Pfam:AA_permease 43 463 6.3e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000195970
AA Change: L246P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143091
Gene: ENSMUSG00000000958
AA Change: L246P

DomainStartEndE-ValueType
Pfam:AA_permease_2 38 462 6.4e-66 PFAM
Pfam:AA_permease 43 467 5.3e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196966
Predicted Effect probably damaging
Transcript: ENSMUST00000197440
AA Change: L246P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143743
Gene: ENSMUSG00000000958
AA Change: L246P

DomainStartEndE-ValueType
Pfam:AA_permease_2 38 463 2e-64 PFAM
Pfam:AA_permease 43 463 6.3e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197667
Predicted Effect probably benign
Transcript: ENSMUST00000200545
SMART Domains Protein: ENSMUSP00000142587
Gene: ENSMUSG00000000958

DomainStartEndE-ValueType
Pfam:Trp_Tyr_perm 36 183 7.5e-5 PFAM
Pfam:AA_permease_2 38 186 4.3e-19 PFAM
Pfam:AA_permease 43 185 2.4e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000226753
AA Change: L246P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000228488
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the light subunit of a cationic amino acid transporter. This sodium-independent transporter is formed when the light subunit encoded by this gene dimerizes with the heavy subunit transporter protein SLC3A2. This transporter is found in epithelial cell membranes where it transfers cationic and large neutral amino acids from the cell to the extracellular space. Defects in this gene are a cause of lysinuric protein intolerance (LPI). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2011]
PHENOTYPE: Homozygous null mice exhibit fetal growth retardation and often die neonatally. After heavy protein ingestion, surviving adults show a metabolic derangement akin to lysinuric protein intolerance and including a lasting postnatal growth retardation, splenomegaly, hyperammonemia, and aminoaciduria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 A G 14: 78,748,193 (GRCm39) V1398A probably benign Het
Ampd3 T A 7: 110,394,998 (GRCm39) F316I probably damaging Het
Ampd3 C A 7: 110,394,997 (GRCm39) D315E probably damaging Het
Arhgef40 A C 14: 52,234,431 (GRCm39) E911D probably damaging Het
Atxn2l A G 7: 126,100,588 (GRCm39) probably null Het
Bckdhb T G 9: 83,835,789 (GRCm39) F98V probably damaging Het
Calhm1 C T 19: 47,132,280 (GRCm39) V112I probably benign Het
Ccdc28a G A 10: 18,100,699 (GRCm39) R90C probably damaging Het
Cdc40 A T 10: 40,724,048 (GRCm39) Y247N probably benign Het
Cds1 G A 5: 101,962,299 (GRCm39) V305M probably damaging Het
Cep128 T G 12: 90,966,309 (GRCm39) probably benign Het
Cep72 A T 13: 74,186,423 (GRCm39) H249Q probably damaging Het
Cfap70 A T 14: 20,498,631 (GRCm39) Y19N probably damaging Het
Col11a1 T C 3: 114,012,364 (GRCm39) probably benign Het
Cstdc6 T C 16: 36,143,386 (GRCm39) probably null Het
Cysltr1 A G X: 105,622,261 (GRCm39) V75A possibly damaging Het
Dnaaf11 T A 15: 66,252,323 (GRCm39) M448L probably benign Het
Dnah17 G T 11: 117,981,575 (GRCm39) Y1716* probably null Het
Dnm1 T C 2: 32,225,836 (GRCm39) E383G possibly damaging Het
Dst C A 1: 34,329,437 (GRCm39) probably null Het
Edil3 T C 13: 89,332,968 (GRCm39) S375P probably damaging Het
Eme1 A G 11: 94,540,908 (GRCm39) C277R probably damaging Het
Enam T C 5: 88,640,886 (GRCm39) W183R possibly damaging Het
Fbxl6 C T 15: 76,420,953 (GRCm39) V341M probably benign Het
Fgf14 A G 14: 124,914,015 (GRCm39) S39P probably damaging Het
Fmo4 C T 1: 162,631,220 (GRCm39) R249H possibly damaging Het
Gle1 T A 2: 29,830,240 (GRCm39) D265E probably benign Het
Gml2 T C 15: 74,693,235 (GRCm39) probably null Het
Golgb1 G T 16: 36,736,692 (GRCm39) E1980* probably null Het
Hap1 A G 11: 100,240,131 (GRCm39) L555P probably damaging Het
Heca T C 10: 17,791,039 (GRCm39) D339G possibly damaging Het
Hepacam2 T C 6: 3,483,479 (GRCm39) T101A possibly damaging Het
Ift88 T C 14: 57,733,678 (GRCm39) V707A probably benign Het
Kdm3a C T 6: 71,597,030 (GRCm39) G252D probably benign Het
Klhl11 A G 11: 100,363,068 (GRCm39) Y163H probably damaging Het
Kntc1 A T 5: 123,924,137 (GRCm39) N1008Y probably damaging Het
Lrp2 G T 2: 69,316,587 (GRCm39) N2131K probably benign Het
Magi3 C G 3: 103,924,873 (GRCm39) G1092A probably damaging Het
Mef2a G T 7: 66,884,896 (GRCm39) S406* probably null Het
Minar2 A G 18: 59,195,531 (GRCm39) probably null Het
Mrps26 G T 2: 130,405,778 (GRCm39) R27L possibly damaging Het
Myof T C 19: 37,904,952 (GRCm39) D1624G probably damaging Het
Naif1 T C 2: 32,344,908 (GRCm39) M204T probably benign Het
Ndufb8 T C 19: 44,538,784 (GRCm39) E179G possibly damaging Het
Neb A T 2: 52,216,769 (GRCm39) D135E probably benign Het
Nlrp6 C T 7: 140,503,399 (GRCm39) Q502* probably null Het
Nploc4 A G 11: 120,304,507 (GRCm39) L238P probably damaging Het
Obi1 T C 14: 104,716,963 (GRCm39) Y470C probably damaging Het
Or4d2 G A 11: 87,784,022 (GRCm39) H243Y probably damaging Het
Parp4 T A 14: 56,839,861 (GRCm39) V523E probably damaging Het
Pdgfra T C 5: 75,324,438 (GRCm39) Y98H probably damaging Het
Plcz1 C T 6: 139,936,459 (GRCm39) R590H probably damaging Het
Pnliprp1 T A 19: 58,726,628 (GRCm39) Y328* probably null Het
Pnpla8 C T 12: 44,330,246 (GRCm39) P48L probably benign Het
Rab44 T A 17: 29,366,317 (GRCm39) probably null Het
Ranbp2 T C 10: 58,329,720 (GRCm39) I3031T probably damaging Het
Sbno1 T C 5: 124,522,604 (GRCm39) D1072G probably damaging Het
Senp7 A G 16: 55,944,236 (GRCm39) T187A possibly damaging Het
Serpinh1 A G 7: 98,998,601 (GRCm39) C10R unknown Het
Sh2d4a A G 8: 68,799,346 (GRCm39) Y405C possibly damaging Het
Slc26a7 T C 4: 14,621,317 (GRCm39) D23G probably benign Het
Spire1 T C 18: 67,661,945 (GRCm39) R163G probably damaging Het
Stxbp2 T A 8: 3,682,559 (GRCm39) D49E probably damaging Het
Susd2 C T 10: 75,474,069 (GRCm39) A509T probably benign Het
Sycp2 A G 2: 178,024,197 (GRCm39) F396L probably damaging Het
Syne2 T C 12: 76,010,587 (GRCm39) L2499P probably damaging Het
Syt10 C A 15: 89,711,144 (GRCm39) A130S probably benign Het
Sytl4 A T X: 132,862,936 (GRCm39) D16E probably benign Het
Tab2 C T 10: 7,795,883 (GRCm39) V126I probably damaging Het
Tecpr1 T C 5: 144,148,317 (GRCm39) T363A probably damaging Het
Terb2 A G 2: 122,016,816 (GRCm39) D16G probably benign Het
Tm2d2 A G 8: 25,510,552 (GRCm39) E137G probably benign Het
Trim30d T A 7: 104,121,692 (GRCm39) H201L probably damaging Het
Tspan3 A G 9: 56,054,669 (GRCm39) probably null Het
Ttn A T 2: 76,626,529 (GRCm39) probably null Het
Ttn A T 2: 76,617,667 (GRCm39) L16268Q probably damaging Het
Ubap2 T A 4: 41,218,319 (GRCm39) T263S probably benign Het
Vmn2r100 C A 17: 19,742,382 (GRCm39) P252Q possibly damaging Het
Zeb2 A T 2: 44,886,138 (GRCm39) M973K possibly damaging Het
Zfp229 A G 17: 21,965,615 (GRCm39) E615G probably damaging Het
Zfp655 T A 5: 145,180,867 (GRCm39) S242T possibly damaging Het
Zfp788 T A 7: 41,297,705 (GRCm39) F62I possibly damaging Het
Zmynd8 A G 2: 165,629,078 (GRCm39) probably null Het
Other mutations in Slc7a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0200:Slc7a7 UTSW 14 54,615,259 (GRCm39) missense probably damaging 1.00
R0331:Slc7a7 UTSW 14 54,615,381 (GRCm39) unclassified probably benign
R1311:Slc7a7 UTSW 14 54,610,487 (GRCm39) nonsense probably null
R1489:Slc7a7 UTSW 14 54,646,103 (GRCm39) missense probably damaging 1.00
R1490:Slc7a7 UTSW 14 54,646,103 (GRCm39) missense probably damaging 1.00
R4049:Slc7a7 UTSW 14 54,610,548 (GRCm39) critical splice acceptor site probably null
R4731:Slc7a7 UTSW 14 54,646,190 (GRCm39) missense probably damaging 1.00
R4732:Slc7a7 UTSW 14 54,646,190 (GRCm39) missense probably damaging 1.00
R4733:Slc7a7 UTSW 14 54,646,190 (GRCm39) missense probably damaging 1.00
R5562:Slc7a7 UTSW 14 54,646,269 (GRCm39) missense probably benign
R5745:Slc7a7 UTSW 14 54,615,292 (GRCm39) missense possibly damaging 0.46
R5907:Slc7a7 UTSW 14 54,616,560 (GRCm39) missense probably damaging 1.00
R6140:Slc7a7 UTSW 14 54,616,515 (GRCm39) missense probably damaging 1.00
R6366:Slc7a7 UTSW 14 54,612,057 (GRCm39) missense probably damaging 1.00
R6696:Slc7a7 UTSW 14 54,615,218 (GRCm39) splice site probably null
R6776:Slc7a7 UTSW 14 54,612,108 (GRCm39) missense possibly damaging 0.95
R7310:Slc7a7 UTSW 14 54,616,482 (GRCm39) missense probably damaging 0.99
R7399:Slc7a7 UTSW 14 54,611,725 (GRCm39) missense possibly damaging 0.87
R7903:Slc7a7 UTSW 14 54,611,366 (GRCm39) missense probably damaging 1.00
R8679:Slc7a7 UTSW 14 54,610,449 (GRCm39) missense probably benign 0.31
R8888:Slc7a7 UTSW 14 54,607,293 (GRCm39) missense probably benign
R8895:Slc7a7 UTSW 14 54,607,293 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGCAAGAAAGCGCACATCTGC -3'
(R):5'- GAAGAACACCACCTGTTTCTAGCCC -3'

Sequencing Primer
(F):5'- TCTGCACACAGTCACTACATACAG -3'
(R):5'- CAGGAGCCACAGCTAACTTT -3'
Posted On 2013-07-11