Incidental Mutation 'R6998:Krt79'
ID 544370
Institutional Source Beutler Lab
Gene Symbol Krt79
Ensembl Gene ENSMUSG00000061397
Gene Name keratin 79
Synonyms
MMRRC Submission 045010-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6998 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 101837767-101848759 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 101846307 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 214 (M214V)
Ref Sequence ENSEMBL: ENSMUSP00000023799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023799]
AlphaFold Q8VED5
Predicted Effect probably benign
Transcript: ENSMUST00000023799
AA Change: M214V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023799
Gene: ENSMUSG00000061397
AA Change: M214V

DomainStartEndE-ValueType
Pfam:Keratin_2_head 15 98 6.6e-11 PFAM
Pfam:Keratin_2_head 73 135 1.2e-21 PFAM
Filament 138 452 7.12e-159 SMART
low complexity region 474 500 N/A INTRINSIC
low complexity region 519 530 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into epithelial keratins and hair keratins. This gene encodes an epithelial keratin that is expressed in skeletal muscle, skin and scalp. The type II keratins are clustered in a region of chromosome 12q13.[provided by RefSeq, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam30 A G 3: 98,070,026 (GRCm39) R620G probably benign Het
Adcy1 A C 11: 7,029,026 (GRCm39) N259H probably damaging Het
Ahctf1 G A 1: 179,598,480 (GRCm39) R2* probably null Het
Akr1c21 A G 13: 4,633,850 (GRCm39) I306M probably benign Het
Alg9 T A 9: 50,700,921 (GRCm39) S230R possibly damaging Het
Armt1 T A 10: 4,403,937 (GRCm39) C341S probably benign Het
Aspg T A 12: 112,078,628 (GRCm39) L29M probably damaging Het
Aspm C T 1: 139,397,210 (GRCm39) T934I probably damaging Het
C1rl T C 6: 124,485,861 (GRCm39) S411P probably damaging Het
Card14 A G 11: 119,213,725 (GRCm39) E224G probably damaging Het
Ccdc88c T C 12: 100,883,111 (GRCm39) H1587R probably damaging Het
Ccp110 A G 7: 118,332,120 (GRCm39) T963A possibly damaging Het
Cdk11b G A 4: 155,732,800 (GRCm39) W546* probably null Het
Cyp8b1 T C 9: 121,745,059 (GRCm39) N91S probably benign Het
Dab2 G T 15: 6,454,130 (GRCm39) M213I possibly damaging Het
Decr1 A G 4: 15,930,960 (GRCm39) V124A probably damaging Het
Fbxl13 T A 5: 21,748,687 (GRCm39) I411F probably damaging Het
Fbxl13 T C 5: 21,825,611 (GRCm39) I164V probably null Het
Fndc7 G A 3: 108,783,964 (GRCm39) A215V probably benign Het
Garem2 T C 5: 30,319,168 (GRCm39) M210T possibly damaging Het
Gpatch2l G A 12: 86,290,958 (GRCm39) R47H probably damaging Het
Ighv1-52 C A 12: 115,109,112 (GRCm39) A115S probably benign Het
Igkv6-13 A G 6: 70,434,573 (GRCm39) S91P probably damaging Het
Ints8 T A 4: 11,204,537 (GRCm39) E973V possibly damaging Het
Itga3 T C 11: 94,942,288 (GRCm39) K972R probably benign Het
Klhl33 A T 14: 51,130,478 (GRCm39) F339I probably benign Het
Lgsn A T 1: 31,243,274 (GRCm39) H452L probably benign Het
Limd2 C T 11: 106,049,516 (GRCm39) G124D probably benign Het
Luzp1 T C 4: 136,270,755 (GRCm39) S993P probably damaging Het
Maml2 C T 9: 13,532,481 (GRCm39) probably benign Het
Mbtd1 A T 11: 93,815,438 (GRCm39) H342L probably damaging Het
Mfhas1 C A 8: 36,058,510 (GRCm39) P995Q probably damaging Het
Muc5ac T C 7: 141,372,451 (GRCm39) F3399S possibly damaging Het
Napb T C 2: 148,542,345 (GRCm39) Y205C probably damaging Het
Odf2 G T 2: 29,802,629 (GRCm39) A298S probably benign Het
Or11g7 A T 14: 50,690,890 (GRCm39) Y127F probably benign Het
Or4s2b A T 2: 88,508,852 (GRCm39) I218F probably benign Het
Or8k35 A T 2: 86,424,488 (GRCm39) M228K probably damaging Het
Pcsk5 T C 19: 17,450,476 (GRCm39) D1124G probably benign Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 (GRCm39) probably benign Het
Pik3c2b T G 1: 133,030,110 (GRCm39) I1457S probably benign Het
Pole2 T C 12: 69,260,680 (GRCm39) T167A possibly damaging Het
Rfx7 T A 9: 72,525,787 (GRCm39) S992R probably damaging Het
Ryr2 G T 13: 11,727,052 (GRCm39) S2436R probably damaging Het
Sgo2a A G 1: 58,055,799 (GRCm39) D661G probably damaging Het
Sh3glb2 T A 2: 30,245,333 (GRCm39) T49S probably damaging Het
Slc16a10 T C 10: 39,932,499 (GRCm39) K354R possibly damaging Het
Slc6a6 C A 6: 91,729,419 (GRCm39) T568K probably benign Het
Sptbn1 T C 11: 30,050,633 (GRCm39) T2319A probably damaging Het
Tbl1xr1 T A 3: 22,233,454 (GRCm39) Y15N probably damaging Het
Thyn1 T C 9: 26,917,738 (GRCm39) S160P probably damaging Het
Tshz1 A T 18: 84,033,966 (GRCm39) D147E probably benign Het
Vmn2r50 T G 7: 9,771,684 (GRCm39) R672S probably benign Het
Zfp663 A T 2: 165,195,922 (GRCm39) I99N possibly damaging Het
Other mutations in Krt79
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Krt79 APN 15 101,848,601 (GRCm39) missense probably damaging 0.98
IGL00546:Krt79 APN 15 101,838,308 (GRCm39) missense probably benign 0.00
IGL01595:Krt79 APN 15 101,840,206 (GRCm39) missense probably damaging 0.98
IGL02193:Krt79 APN 15 101,848,340 (GRCm39) missense possibly damaging 0.59
R0639:Krt79 UTSW 15 101,839,983 (GRCm39) nonsense probably null
R0980:Krt79 UTSW 15 101,846,442 (GRCm39) missense probably damaging 1.00
R1839:Krt79 UTSW 15 101,846,373 (GRCm39) missense possibly damaging 0.81
R4624:Krt79 UTSW 15 101,848,241 (GRCm39) missense possibly damaging 0.92
R4745:Krt79 UTSW 15 101,839,119 (GRCm39) missense probably damaging 1.00
R5203:Krt79 UTSW 15 101,838,175 (GRCm39) missense unknown
R5382:Krt79 UTSW 15 101,839,875 (GRCm39) missense probably benign 0.09
R5568:Krt79 UTSW 15 101,838,220 (GRCm39) missense probably damaging 0.99
R6902:Krt79 UTSW 15 101,840,314 (GRCm39) missense probably benign 0.08
R6916:Krt79 UTSW 15 101,844,605 (GRCm39) missense probably benign 0.01
R7009:Krt79 UTSW 15 101,839,876 (GRCm39) missense probably damaging 1.00
R7663:Krt79 UTSW 15 101,840,278 (GRCm39) missense probably damaging 0.97
R8161:Krt79 UTSW 15 101,839,137 (GRCm39) missense probably damaging 0.96
R8184:Krt79 UTSW 15 101,838,187 (GRCm39) missense unknown
R8206:Krt79 UTSW 15 101,848,705 (GRCm39) start gained probably null
R8705:Krt79 UTSW 15 101,846,441 (GRCm39) missense probably damaging 1.00
R8993:Krt79 UTSW 15 101,839,441 (GRCm39) intron probably benign
R9055:Krt79 UTSW 15 101,839,922 (GRCm39) missense probably damaging 1.00
R9322:Krt79 UTSW 15 101,840,245 (GRCm39) missense possibly damaging 0.92
R9456:Krt79 UTSW 15 101,839,904 (GRCm39) missense probably benign 0.02
R9495:Krt79 UTSW 15 101,840,288 (GRCm39) missense probably damaging 1.00
R9514:Krt79 UTSW 15 101,840,288 (GRCm39) missense probably damaging 1.00
R9533:Krt79 UTSW 15 101,848,417 (GRCm39) missense possibly damaging 0.55
R9560:Krt79 UTSW 15 101,846,277 (GRCm39) missense probably damaging 0.99
R9705:Krt79 UTSW 15 101,839,196 (GRCm39) missense probably benign
R9706:Krt79 UTSW 15 101,839,196 (GRCm39) missense probably benign
R9707:Krt79 UTSW 15 101,839,196 (GRCm39) missense probably benign
R9714:Krt79 UTSW 15 101,839,196 (GRCm39) missense probably benign
R9750:Krt79 UTSW 15 101,839,196 (GRCm39) missense probably benign
R9751:Krt79 UTSW 15 101,839,196 (GRCm39) missense probably benign
R9753:Krt79 UTSW 15 101,839,196 (GRCm39) missense probably benign
R9772:Krt79 UTSW 15 101,839,196 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GTAATCCCTGAGGCTGAGCAAG -3'
(R):5'- GGTACGCTTCCTGGAACAACAG -3'

Sequencing Primer
(F):5'- CGAGAGTGAGACCCTGTCTG -3'
(R):5'- CTTCCTGGAACAACAGAACAAGGTG -3'
Posted On 2019-05-13