Mutagenetix > Incidental Mutation

Incidental Mutation 'R6998:Krt79'

544370

Institutional Source

Beutler Lab

Gene Symbol

Krt79

Ensembl Gene

ENSMUSG00000061397

Gene Name

keratin 79

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6998 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

101929332-101940324 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 101937872 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 214 (M214V)

Ref Sequence

ENSEMBL: ENSMUSP00000023799 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023799]

AlphaFold

Q8VED5

Predicted Effect

probably benign
Transcript: ENSMUST00000023799
AA Change: M214V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000023799
Gene: ENSMUSG00000061397
AA Change: M214V

Domain	Start	End	E-Value	Type
Pfam:Keratin_2_head	15	98	6.6e-11	PFAM
Pfam:Keratin_2_head	73	135	1.2e-21	PFAM
Filament	138	452	7.12e-159	SMART
low complexity region	474	500	N/A	INTRINSIC
low complexity region	519	530	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into epithelial keratins and hair keratins. This gene encodes an epithelial keratin that is expressed in skeletal muscle, skin and scalp. The type II keratins are clustered in a region of chromosome 12q13.[provided by RefSeq, Jun 2009]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam30	A	G	3: 98,162,710	R620G	probably benign	Het
Adcy1	A	C	11: 7,079,026	N259H	probably damaging	Het
Ahctf1	G	A	1: 179,770,915	R2*	probably null	Het
Akr1c21	A	G	13: 4,583,851	I306M	probably benign	Het
Alg9	T	A	9: 50,789,621	S230R	possibly damaging	Het
Armt1	T	A	10: 4,453,937	C341S	probably benign	Het
Aspg	T	A	12: 112,112,194	L29M	probably damaging	Het
Aspm	C	T	1: 139,469,472	T934I	probably damaging	Het
C1rl	T	C	6: 124,508,902	S411P	probably damaging	Het
Card14	A	G	11: 119,322,899	E224G	probably damaging	Het
Ccdc88c	T	C	12: 100,916,852	H1587R	probably damaging	Het
Ccp110	A	G	7: 118,732,897	T963A	possibly damaging	Het
Cdk11b	G	A	4: 155,648,343	W546*	probably null	Het
Cyp8b1	T	C	9: 121,915,993	N91S	probably benign	Het
Dab2	G	T	15: 6,424,649	M213I	possibly damaging	Het
Decr1	A	G	4: 15,930,960	V124A	probably damaging	Het
Fbxl13	T	A	5: 21,543,689	I411F	probably damaging	Het
Fbxl13	T	C	5: 21,620,613	I164V	probably null	Het
Fndc7	G	A	3: 108,876,648	A215V	probably benign	Het
Garem2	T	C	5: 30,114,170	M210T	possibly damaging	Het
Gpatch2l	G	A	12: 86,244,184	R47H	probably damaging	Het
Ighv1-52	C	A	12: 115,145,492	A115S	probably benign	Het
Igkv6-13	A	G	6: 70,457,589	S91P	probably damaging	Het
Ints8	T	A	4: 11,204,537	E973V	possibly damaging	Het
Itga3	T	C	11: 95,051,462	K972R	probably benign	Het
Klhl33	A	T	14: 50,893,021	F339I	probably benign	Het
Lgsn	A	T	1: 31,204,193	H452L	probably benign	Het
Limd2	C	T	11: 106,158,690	G124D	probably benign	Het
Luzp1	T	C	4: 136,543,444	S993P	probably damaging	Het
Maml2	C	T	9: 13,621,185		probably benign	Het
Mbtd1	A	T	11: 93,924,612	H342L	probably damaging	Het
Mfhas1	C	A	8: 35,591,356	P995Q	probably damaging	Het
Muc5ac	T	C	7: 141,818,714	F3399S	possibly damaging	Het
Napb	T	C	2: 148,700,425	Y205C	probably damaging	Het
Odf2	G	T	2: 29,912,617	A298S	probably benign	Het
Olfr1082	A	T	2: 86,594,144	M228K	probably damaging	Het
Olfr1193	A	T	2: 88,678,508	I218F	probably benign	Het
Olfr740	A	T	14: 50,453,433	Y127F	probably benign	Het
Pcsk5	T	C	19: 17,473,112	D1124G	probably benign	Het
Peg10	CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG	CCACATCAGGATCCACATCAGGATGCACATCAG	6: 4,756,398		probably benign	Het
Pik3c2b	T	G	1: 133,102,372	I1457S	probably benign	Het
Pole2	T	C	12: 69,213,906	T167A	possibly damaging	Het
Rfx7	T	A	9: 72,618,505	S992R	probably damaging	Het
Ryr2	G	T	13: 11,712,166	S2436R	probably damaging	Het
Sgo2a	A	G	1: 58,016,640	D661G	probably damaging	Het
Sh3glb2	T	A	2: 30,355,321	T49S	probably damaging	Het
Slc16a10	T	C	10: 40,056,503	K354R	possibly damaging	Het
Slc6a6	C	A	6: 91,752,438	T568K	probably benign	Het
Sptbn1	T	C	11: 30,100,633	T2319A	probably damaging	Het
Tbl1xr1	T	A	3: 22,179,290	Y15N	probably damaging	Het
Thyn1	T	C	9: 27,006,442	S160P	probably damaging	Het
Tshz1	A	T	18: 84,015,841	D147E	probably benign	Het
Vmn2r50	T	G	7: 10,037,757	R672S	probably benign	Het
Zfp663	A	T	2: 165,354,002	I99N	possibly damaging	Het

Other mutations in Krt79

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Krt79	APN	15	101940166	missense	probably damaging	0.98
IGL00546:Krt79	APN	15	101929873	missense	probably benign	0.00
IGL01595:Krt79	APN	15	101931771	missense	probably damaging	0.98
IGL02193:Krt79	APN	15	101939905	missense	possibly damaging	0.59
R0639:Krt79	UTSW	15	101931548	nonsense	probably null
R0980:Krt79	UTSW	15	101938007	missense	probably damaging	1.00
R1839:Krt79	UTSW	15	101937938	missense	possibly damaging	0.81
R4624:Krt79	UTSW	15	101939806	missense	possibly damaging	0.92
R4745:Krt79	UTSW	15	101930684	missense	probably damaging	1.00
R5203:Krt79	UTSW	15	101929740	missense	unknown
R5382:Krt79	UTSW	15	101931440	missense	probably benign	0.09
R5568:Krt79	UTSW	15	101929785	missense	probably damaging	0.99
R6902:Krt79	UTSW	15	101931879	missense	probably benign	0.08
R6916:Krt79	UTSW	15	101936170	missense	probably benign	0.01
R7009:Krt79	UTSW	15	101931441	missense	probably damaging	1.00
R7663:Krt79	UTSW	15	101931843	missense	probably damaging	0.97
R8161:Krt79	UTSW	15	101930702	missense	probably damaging	0.96
R8184:Krt79	UTSW	15	101929752	missense	unknown
R8206:Krt79	UTSW	15	101940270	start gained	probably null
R8705:Krt79	UTSW	15	101938006	missense	probably damaging	1.00
R8993:Krt79	UTSW	15	101931006	intron	probably benign
R9055:Krt79	UTSW	15	101931487	missense	probably damaging	1.00
R9322:Krt79	UTSW	15	101931810	missense	possibly damaging	0.92
R9456:Krt79	UTSW	15	101931469	missense	probably benign	0.02
R9495:Krt79	UTSW	15	101931853	missense	probably damaging	1.00
R9514:Krt79	UTSW	15	101931853	missense	probably damaging	1.00
R9533:Krt79	UTSW	15	101939982	missense	possibly damaging	0.55
R9560:Krt79	UTSW	15	101937842	missense	probably damaging	0.99
R9705:Krt79	UTSW	15	101930761	missense	probably benign
R9706:Krt79	UTSW	15	101930761	missense	probably benign
R9707:Krt79	UTSW	15	101930761	missense	probably benign
R9714:Krt79	UTSW	15	101930761	missense	probably benign
R9750:Krt79	UTSW	15	101930761	missense	probably benign
R9751:Krt79	UTSW	15	101930761	missense	probably benign
R9753:Krt79	UTSW	15	101930761	missense	probably benign
R9772:Krt79	UTSW	15	101930761	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GTAATCCCTGAGGCTGAGCAAG -3'
(R):5'- GGTACGCTTCCTGGAACAACAG -3'

Sequencing Primer
(F):5'- CGAGAGTGAGACCCTGTCTG -3'
(R):5'- CTTCCTGGAACAACAGAACAAGGTG -3'

Posted On

2019-05-13