Incidental Mutation 'R0608:Parp4'
ID 54438
Institutional Source Beutler Lab
Gene Symbol Parp4
Ensembl Gene ENSMUSG00000054509
Gene Name poly (ADP-ribose) polymerase family, member 4
Synonyms VPARP, Adprtl1, C030027K23Rik, VAULT3, p193, PH5P, E230037B21Rik
MMRRC Submission 038797-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.151) question?
Stock # R0608 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 56813076-56897251 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 56839861 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 523 (V523E)
Ref Sequence ENSEMBL: ENSMUSP00000124258 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161553]
AlphaFold E9PYK3
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160334
Predicted Effect probably damaging
Transcript: ENSMUST00000161553
AA Change: V523E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124258
Gene: ENSMUSG00000054509
AA Change: V523E

DomainStartEndE-ValueType
BRCT 3 84 4.32e-9 SMART
low complexity region 97 104 N/A INTRINSIC
SCOP:d1a26_1 252 352 2e-19 SMART
Pfam:PARP 371 559 1.8e-50 PFAM
VIT 600 728 1.5e-57 SMART
VWA 867 1030 6.08e-13 SMART
Blast:14_3_3 1149 1205 5e-10 BLAST
low complexity region 1255 1264 N/A INTRINSIC
low complexity region 1348 1362 N/A INTRINSIC
low complexity region 1371 1394 N/A INTRINSIC
internal_repeat_1 1395 1416 4.48e-6 PROSPERO
Pfam:Drf_FH1 1443 1542 3.3e-15 PFAM
low complexity region 1553 1587 N/A INTRINSIC
internal_repeat_2 1588 1608 2.45e-5 PROSPERO
low complexity region 1695 1708 N/A INTRINSIC
low complexity region 1739 1750 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes poly(ADP-ribosyl)transferase-like 1 protein, which is capable of catalyzing a poly(ADP-ribosyl)ation reaction. This protein has a catalytic domain which is homologous to that of poly (ADP-ribosyl) transferase, but lacks an N-terminal DNA binding domain which activates the C-terminal catalytic domain of poly (ADP-ribosyl) transferase. Since this protein is not capable of binding DNA directly, its transferase activity may be activated by other factors such as protein-protein interaction mediated by the extensive carboxyl terminus. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are helathy and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 A G 14: 78,748,193 (GRCm39) V1398A probably benign Het
Ampd3 C A 7: 110,394,997 (GRCm39) D315E probably damaging Het
Ampd3 T A 7: 110,394,998 (GRCm39) F316I probably damaging Het
Arhgef40 A C 14: 52,234,431 (GRCm39) E911D probably damaging Het
Atxn2l A G 7: 126,100,588 (GRCm39) probably null Het
Bckdhb T G 9: 83,835,789 (GRCm39) F98V probably damaging Het
Calhm1 C T 19: 47,132,280 (GRCm39) V112I probably benign Het
Ccdc28a G A 10: 18,100,699 (GRCm39) R90C probably damaging Het
Cdc40 A T 10: 40,724,048 (GRCm39) Y247N probably benign Het
Cds1 G A 5: 101,962,299 (GRCm39) V305M probably damaging Het
Cep128 T G 12: 90,966,309 (GRCm39) probably benign Het
Cep72 A T 13: 74,186,423 (GRCm39) H249Q probably damaging Het
Cfap70 A T 14: 20,498,631 (GRCm39) Y19N probably damaging Het
Col11a1 T C 3: 114,012,364 (GRCm39) probably benign Het
Cstdc6 T C 16: 36,143,386 (GRCm39) probably null Het
Cysltr1 A G X: 105,622,261 (GRCm39) V75A possibly damaging Het
Dnaaf11 T A 15: 66,252,323 (GRCm39) M448L probably benign Het
Dnah17 G T 11: 117,981,575 (GRCm39) Y1716* probably null Het
Dnm1 T C 2: 32,225,836 (GRCm39) E383G possibly damaging Het
Dst C A 1: 34,329,437 (GRCm39) probably null Het
Edil3 T C 13: 89,332,968 (GRCm39) S375P probably damaging Het
Eme1 A G 11: 94,540,908 (GRCm39) C277R probably damaging Het
Enam T C 5: 88,640,886 (GRCm39) W183R possibly damaging Het
Fbxl6 C T 15: 76,420,953 (GRCm39) V341M probably benign Het
Fgf14 A G 14: 124,914,015 (GRCm39) S39P probably damaging Het
Fmo4 C T 1: 162,631,220 (GRCm39) R249H possibly damaging Het
Gle1 T A 2: 29,830,240 (GRCm39) D265E probably benign Het
Gml2 T C 15: 74,693,235 (GRCm39) probably null Het
Golgb1 G T 16: 36,736,692 (GRCm39) E1980* probably null Het
Hap1 A G 11: 100,240,131 (GRCm39) L555P probably damaging Het
Heca T C 10: 17,791,039 (GRCm39) D339G possibly damaging Het
Hepacam2 T C 6: 3,483,479 (GRCm39) T101A possibly damaging Het
Ift88 T C 14: 57,733,678 (GRCm39) V707A probably benign Het
Kdm3a C T 6: 71,597,030 (GRCm39) G252D probably benign Het
Klhl11 A G 11: 100,363,068 (GRCm39) Y163H probably damaging Het
Kntc1 A T 5: 123,924,137 (GRCm39) N1008Y probably damaging Het
Lrp2 G T 2: 69,316,587 (GRCm39) N2131K probably benign Het
Magi3 C G 3: 103,924,873 (GRCm39) G1092A probably damaging Het
Mef2a G T 7: 66,884,896 (GRCm39) S406* probably null Het
Minar2 A G 18: 59,195,531 (GRCm39) probably null Het
Mrps26 G T 2: 130,405,778 (GRCm39) R27L possibly damaging Het
Myof T C 19: 37,904,952 (GRCm39) D1624G probably damaging Het
Naif1 T C 2: 32,344,908 (GRCm39) M204T probably benign Het
Ndufb8 T C 19: 44,538,784 (GRCm39) E179G possibly damaging Het
Neb A T 2: 52,216,769 (GRCm39) D135E probably benign Het
Nlrp6 C T 7: 140,503,399 (GRCm39) Q502* probably null Het
Nploc4 A G 11: 120,304,507 (GRCm39) L238P probably damaging Het
Obi1 T C 14: 104,716,963 (GRCm39) Y470C probably damaging Het
Or4d2 G A 11: 87,784,022 (GRCm39) H243Y probably damaging Het
Pdgfra T C 5: 75,324,438 (GRCm39) Y98H probably damaging Het
Plcz1 C T 6: 139,936,459 (GRCm39) R590H probably damaging Het
Pnliprp1 T A 19: 58,726,628 (GRCm39) Y328* probably null Het
Pnpla8 C T 12: 44,330,246 (GRCm39) P48L probably benign Het
Rab44 T A 17: 29,366,317 (GRCm39) probably null Het
Ranbp2 T C 10: 58,329,720 (GRCm39) I3031T probably damaging Het
Sbno1 T C 5: 124,522,604 (GRCm39) D1072G probably damaging Het
Senp7 A G 16: 55,944,236 (GRCm39) T187A possibly damaging Het
Serpinh1 A G 7: 98,998,601 (GRCm39) C10R unknown Het
Sh2d4a A G 8: 68,799,346 (GRCm39) Y405C possibly damaging Het
Slc26a7 T C 4: 14,621,317 (GRCm39) D23G probably benign Het
Slc7a7 A G 14: 54,615,259 (GRCm39) L246P probably damaging Het
Spire1 T C 18: 67,661,945 (GRCm39) R163G probably damaging Het
Stxbp2 T A 8: 3,682,559 (GRCm39) D49E probably damaging Het
Susd2 C T 10: 75,474,069 (GRCm39) A509T probably benign Het
Sycp2 A G 2: 178,024,197 (GRCm39) F396L probably damaging Het
Syne2 T C 12: 76,010,587 (GRCm39) L2499P probably damaging Het
Syt10 C A 15: 89,711,144 (GRCm39) A130S probably benign Het
Sytl4 A T X: 132,862,936 (GRCm39) D16E probably benign Het
Tab2 C T 10: 7,795,883 (GRCm39) V126I probably damaging Het
Tecpr1 T C 5: 144,148,317 (GRCm39) T363A probably damaging Het
Terb2 A G 2: 122,016,816 (GRCm39) D16G probably benign Het
Tm2d2 A G 8: 25,510,552 (GRCm39) E137G probably benign Het
Trim30d T A 7: 104,121,692 (GRCm39) H201L probably damaging Het
Tspan3 A G 9: 56,054,669 (GRCm39) probably null Het
Ttn A T 2: 76,617,667 (GRCm39) L16268Q probably damaging Het
Ttn A T 2: 76,626,529 (GRCm39) probably null Het
Ubap2 T A 4: 41,218,319 (GRCm39) T263S probably benign Het
Vmn2r100 C A 17: 19,742,382 (GRCm39) P252Q possibly damaging Het
Zeb2 A T 2: 44,886,138 (GRCm39) M973K possibly damaging Het
Zfp229 A G 17: 21,965,615 (GRCm39) E615G probably damaging Het
Zfp655 T A 5: 145,180,867 (GRCm39) S242T possibly damaging Het
Zfp788 T A 7: 41,297,705 (GRCm39) F62I possibly damaging Het
Zmynd8 A G 2: 165,629,078 (GRCm39) probably null Het
Other mutations in Parp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Parp4 APN 14 56,853,917 (GRCm39) missense possibly damaging 0.82
IGL00571:Parp4 APN 14 56,884,810 (GRCm39) missense unknown
IGL00737:Parp4 APN 14 56,821,620 (GRCm39) missense probably damaging 0.99
IGL00793:Parp4 APN 14 56,840,334 (GRCm39) missense possibly damaging 0.73
IGL01108:Parp4 APN 14 56,844,897 (GRCm39) missense probably benign 0.01
IGL01131:Parp4 APN 14 56,823,217 (GRCm39) splice site probably benign
IGL01485:Parp4 APN 14 56,859,661 (GRCm39) missense possibly damaging 0.54
IGL01704:Parp4 APN 14 56,839,783 (GRCm39) missense probably damaging 0.99
IGL01993:Parp4 APN 14 56,848,245 (GRCm39) missense possibly damaging 0.82
IGL02125:Parp4 APN 14 56,827,959 (GRCm39) missense probably benign 0.33
IGL02851:Parp4 APN 14 56,886,326 (GRCm39) missense unknown
IGL02863:Parp4 APN 14 56,886,243 (GRCm39) missense unknown
IGL03065:Parp4 APN 14 56,875,326 (GRCm39) missense probably benign 0.09
IGL03117:Parp4 APN 14 56,840,313 (GRCm39) missense probably benign 0.17
IGL03271:Parp4 APN 14 56,823,082 (GRCm39) missense probably benign 0.10
IGL03309:Parp4 APN 14 56,825,265 (GRCm39) missense probably benign 0.11
IGL03408:Parp4 APN 14 56,839,865 (GRCm39) missense probably damaging 0.99
poisonous UTSW 14 56,873,205 (GRCm39) missense possibly damaging 0.65
R0515_Parp4_195 UTSW 14 56,851,124 (GRCm39) missense probably damaging 1.00
toxic UTSW 14 56,866,615 (GRCm39) missense probably benign 0.28
venomous UTSW 14 56,827,355 (GRCm39) missense possibly damaging 0.92
virulent UTSW 14 56,825,235 (GRCm39) missense probably damaging 0.97
R0278:Parp4 UTSW 14 56,844,980 (GRCm39) missense probably damaging 0.99
R0320:Parp4 UTSW 14 56,825,953 (GRCm39) critical splice donor site probably null
R0445:Parp4 UTSW 14 56,840,205 (GRCm39) splice site probably null
R0452:Parp4 UTSW 14 56,886,300 (GRCm39) missense unknown
R0511:Parp4 UTSW 14 56,873,172 (GRCm39) splice site probably benign
R0515:Parp4 UTSW 14 56,851,124 (GRCm39) missense probably damaging 1.00
R0800:Parp4 UTSW 14 56,827,408 (GRCm39) missense probably benign 0.00
R0959:Parp4 UTSW 14 56,885,576 (GRCm39) missense unknown
R1207:Parp4 UTSW 14 56,885,339 (GRCm39) missense unknown
R1207:Parp4 UTSW 14 56,885,339 (GRCm39) missense unknown
R1342:Parp4 UTSW 14 56,827,854 (GRCm39) missense probably damaging 1.00
R1520:Parp4 UTSW 14 56,835,863 (GRCm39) missense probably damaging 1.00
R1565:Parp4 UTSW 14 56,827,329 (GRCm39) splice site probably benign
R1574:Parp4 UTSW 14 56,839,752 (GRCm39) missense probably damaging 0.98
R1574:Parp4 UTSW 14 56,839,752 (GRCm39) missense probably damaging 0.98
R1649:Parp4 UTSW 14 56,827,885 (GRCm39) missense possibly damaging 0.95
R1666:Parp4 UTSW 14 56,861,620 (GRCm39) missense possibly damaging 0.91
R1781:Parp4 UTSW 14 56,864,838 (GRCm39) splice site probably null
R1799:Parp4 UTSW 14 56,885,589 (GRCm39) missense unknown
R1823:Parp4 UTSW 14 56,827,329 (GRCm39) splice site probably benign
R1859:Parp4 UTSW 14 56,886,372 (GRCm39) missense unknown
R1919:Parp4 UTSW 14 56,861,474 (GRCm39) missense probably damaging 1.00
R2000:Parp4 UTSW 14 56,851,181 (GRCm39) missense probably damaging 0.98
R2032:Parp4 UTSW 14 56,866,553 (GRCm39) missense possibly damaging 0.71
R2034:Parp4 UTSW 14 56,871,720 (GRCm39) missense probably damaging 1.00
R2177:Parp4 UTSW 14 56,896,746 (GRCm39) missense unknown
R2291:Parp4 UTSW 14 56,851,274 (GRCm39) missense probably damaging 1.00
R2865:Parp4 UTSW 14 56,851,181 (GRCm39) missense probably damaging 0.98
R3012:Parp4 UTSW 14 56,832,873 (GRCm39) critical splice donor site probably null
R3841:Parp4 UTSW 14 56,825,235 (GRCm39) missense probably damaging 0.97
R3913:Parp4 UTSW 14 56,857,975 (GRCm39) missense probably damaging 1.00
R4064:Parp4 UTSW 14 56,861,597 (GRCm39) missense probably benign 0.06
R4201:Parp4 UTSW 14 56,829,848 (GRCm39) missense possibly damaging 0.95
R4288:Parp4 UTSW 14 56,844,951 (GRCm39) missense probably damaging 1.00
R4360:Parp4 UTSW 14 56,866,661 (GRCm39) missense possibly damaging 0.89
R4506:Parp4 UTSW 14 56,889,761 (GRCm39) missense unknown
R4577:Parp4 UTSW 14 56,827,867 (GRCm39) missense probably benign 0.33
R4633:Parp4 UTSW 14 56,885,048 (GRCm39) missense unknown
R4762:Parp4 UTSW 14 56,848,267 (GRCm39) missense probably damaging 1.00
R4836:Parp4 UTSW 14 56,823,195 (GRCm39) missense probably benign 0.00
R4974:Parp4 UTSW 14 56,827,355 (GRCm39) missense possibly damaging 0.92
R5049:Parp4 UTSW 14 56,873,188 (GRCm39) missense possibly damaging 0.81
R5479:Parp4 UTSW 14 56,861,552 (GRCm39) missense probably benign 0.01
R5683:Parp4 UTSW 14 56,884,886 (GRCm39) nonsense probably null
R5884:Parp4 UTSW 14 56,852,207 (GRCm39) missense probably damaging 1.00
R5965:Parp4 UTSW 14 56,861,489 (GRCm39) missense probably benign 0.11
R6001:Parp4 UTSW 14 56,878,740 (GRCm39) missense probably benign 0.01
R6027:Parp4 UTSW 14 56,866,615 (GRCm39) missense probably benign 0.28
R6230:Parp4 UTSW 14 56,844,990 (GRCm39) missense probably damaging 1.00
R6242:Parp4 UTSW 14 56,832,856 (GRCm39) nonsense probably null
R6355:Parp4 UTSW 14 56,839,757 (GRCm39) missense possibly damaging 0.61
R6414:Parp4 UTSW 14 56,864,838 (GRCm39) splice site probably null
R6418:Parp4 UTSW 14 56,858,108 (GRCm39) critical splice donor site probably null
R6477:Parp4 UTSW 14 56,884,694 (GRCm39) missense probably benign 0.00
R6542:Parp4 UTSW 14 56,885,339 (GRCm39) missense unknown
R6759:Parp4 UTSW 14 56,857,947 (GRCm39) missense probably benign 0.10
R6995:Parp4 UTSW 14 56,851,196 (GRCm39) missense probably damaging 0.97
R7002:Parp4 UTSW 14 56,839,861 (GRCm39) missense probably damaging 1.00
R7026:Parp4 UTSW 14 56,858,049 (GRCm39) missense probably benign 0.01
R7062:Parp4 UTSW 14 56,852,216 (GRCm39) missense possibly damaging 0.48
R7101:Parp4 UTSW 14 56,827,430 (GRCm39) missense probably benign 0.02
R7124:Parp4 UTSW 14 56,840,256 (GRCm39) missense probably benign 0.11
R7162:Parp4 UTSW 14 56,886,333 (GRCm39) missense unknown
R7293:Parp4 UTSW 14 56,885,303 (GRCm39) small deletion probably benign
R7297:Parp4 UTSW 14 56,885,138 (GRCm39) missense not run
R7337:Parp4 UTSW 14 56,839,852 (GRCm39) missense probably damaging 1.00
R7539:Parp4 UTSW 14 56,873,212 (GRCm39) missense probably damaging 1.00
R7575:Parp4 UTSW 14 56,875,375 (GRCm39) missense probably benign 0.28
R7808:Parp4 UTSW 14 56,873,205 (GRCm39) missense possibly damaging 0.65
R7854:Parp4 UTSW 14 56,896,805 (GRCm39) missense unknown
R7960:Parp4 UTSW 14 56,832,708 (GRCm39) splice site probably null
R8152:Parp4 UTSW 14 56,884,703 (GRCm39) missense probably benign 0.00
R8344:Parp4 UTSW 14 56,886,186 (GRCm39) missense unknown
R8416:Parp4 UTSW 14 56,825,271 (GRCm39) critical splice donor site probably null
R8726:Parp4 UTSW 14 56,866,556 (GRCm39) missense probably benign 0.04
R8752:Parp4 UTSW 14 56,886,073 (GRCm39) missense unknown
R8804:Parp4 UTSW 14 56,853,900 (GRCm39) nonsense probably null
R9046:Parp4 UTSW 14 56,864,927 (GRCm39) missense probably damaging 0.98
R9176:Parp4 UTSW 14 56,873,274 (GRCm39) missense possibly damaging 0.54
R9303:Parp4 UTSW 14 56,852,224 (GRCm39) critical splice donor site probably null
R9303:Parp4 UTSW 14 56,832,790 (GRCm39) frame shift probably null
R9305:Parp4 UTSW 14 56,852,224 (GRCm39) critical splice donor site probably null
R9305:Parp4 UTSW 14 56,832,790 (GRCm39) frame shift probably null
R9360:Parp4 UTSW 14 56,878,775 (GRCm39) critical splice donor site probably null
R9430:Parp4 UTSW 14 56,866,673 (GRCm39) missense probably damaging 1.00
R9491:Parp4 UTSW 14 56,832,828 (GRCm39) missense probably damaging 0.99
R9729:Parp4 UTSW 14 56,885,888 (GRCm39) missense unknown
RF020:Parp4 UTSW 14 56,884,806 (GRCm39) missense unknown
Z1177:Parp4 UTSW 14 56,829,824 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGCTGTCACACCGATTAATGCTC -3'
(R):5'- TGAAATGGACGCAAGCCTCTGAG -3'

Sequencing Primer
(F):5'- TTAGAGATGCCCAAGCTGTC -3'
(R):5'- TGGCCTTTGCACACTTGG -3'
Posted On 2013-07-11