Incidental Mutation 'R6999:Tubgcp4'
ID544381
Institutional Source Beutler Lab
Gene Symbol Tubgcp4
Ensembl Gene ENSMUSG00000027263
Gene Nametubulin, gamma complex associated protein 4
SynonymsD2Ertd435e, 4932441P04Rik
MMRRC Submission
Accession Numbers

Genbank: NM_153387

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6999 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location121170654-121198770 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 121192297 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 495 (W495R)
Ref Sequence ENSEMBL: ENSMUSP00000140417 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039541] [ENSMUST00000110647] [ENSMUST00000110648] [ENSMUST00000110657] [ENSMUST00000110658] [ENSMUST00000186659]
Predicted Effect probably damaging
Transcript: ENSMUST00000039541
AA Change: W496R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044049
Gene: ENSMUSG00000027263
AA Change: W496R

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 4 573 2.8e-111 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110647
SMART Domains Protein: ENSMUSP00000106277
Gene: ENSMUSG00000043909

DomainStartEndE-ValueType
low complexity region 136 149 N/A INTRINSIC
low complexity region 158 169 N/A INTRINSIC
low complexity region 647 661 N/A INTRINSIC
low complexity region 1031 1042 N/A INTRINSIC
low complexity region 1099 1112 N/A INTRINSIC
low complexity region 1260 1272 N/A INTRINSIC
low complexity region 1290 1332 N/A INTRINSIC
Pfam:53-BP1_Tudor 1430 1551 2.5e-80 PFAM
low complexity region 1581 1601 N/A INTRINSIC
BRCT 1673 1785 7.13e-1 SMART
BRCT 1813 1901 1.03e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110648
SMART Domains Protein: ENSMUSP00000106278
Gene: ENSMUSG00000043909

DomainStartEndE-ValueType
low complexity region 136 149 N/A INTRINSIC
low complexity region 158 169 N/A INTRINSIC
low complexity region 647 661 N/A INTRINSIC
low complexity region 1031 1042 N/A INTRINSIC
low complexity region 1099 1112 N/A INTRINSIC
low complexity region 1260 1272 N/A INTRINSIC
low complexity region 1290 1332 N/A INTRINSIC
low complexity region 1389 1409 N/A INTRINSIC
Pfam:53-BP1_Tudor 1480 1601 1.5e-80 PFAM
low complexity region 1631 1651 N/A INTRINSIC
BRCT 1723 1835 7.13e-1 SMART
BRCT 1863 1951 1.03e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110657
AA Change: W495R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106285
Gene: ENSMUSG00000027263
AA Change: W495R

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 4 572 3.1e-115 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110658
AA Change: W495R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106286
Gene: ENSMUSG00000027263
AA Change: W495R

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 4 572 4.1e-115 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000186659
AA Change: W495R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140417
Gene: ENSMUSG00000027263
AA Change: W495R

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 4 572 4.1e-115 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the gamma-tubulin ring complex, which is required for microtubule nucleation. In mammalian cells, the protein localizes to centrosomes in association with gamma-tubulin. Crystal structure analysis revealed a structure composed of five helical bundles arranged around conserved hydrophobic cores. An exposed surface area located in the C-terminal domain is essential and sufficient for direct binding to gamma-tubulin. Mutations in this gene that alter microtubule organization are associated with microcephaly and chorioretinopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2015]
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 G A 1: 71,317,162 Q629* probably null Het
Acss3 C A 10: 107,053,501 G153C probably damaging Het
Alpk2 A G 18: 65,304,513 S1270P probably damaging Het
Ankrd10 A T 8: 11,619,106 L215Q probably damaging Het
Ankrd6 A G 4: 32,823,459 S188P probably benign Het
Brinp2 A G 1: 158,251,305 M316T probably benign Het
Bsn A G 9: 108,113,433 S1707P probably benign Het
C2cd4b C T 9: 67,760,289 A189V probably benign Het
Camk2b C T 11: 5,972,321 R556H probably damaging Het
Cfap126 A G 1: 171,126,164 D101G possibly damaging Het
Chd5 A T 4: 152,374,434 I1085F probably damaging Het
Chp2 A G 7: 122,221,869 E151G probably damaging Het
Chrd A G 16: 20,735,652 T370A probably benign Het
Chrnb2 C T 3: 89,761,315 R231H possibly damaging Het
Crisp4 T A 1: 18,137,035 I10F possibly damaging Het
Csnka2ip T A 16: 64,478,570 H477L unknown Het
Ctu1 T A 7: 43,675,238 F34I probably damaging Het
Dctn1 T A 6: 83,191,281 S407T possibly damaging Het
E330021D16Rik T C 6: 136,401,274 N186S probably benign Het
Ech1 T C 7: 28,830,264 F191L probably benign Het
Enpp3 T C 10: 24,808,166 D60G probably damaging Het
Epha6 T C 16: 60,425,170 Y222C possibly damaging Het
Eppk1 A T 15: 76,109,223 W1153R probably benign Het
Fbxo4 C T 15: 3,977,955 D76N probably damaging Het
Fndc7 G A 3: 108,876,648 A215V probably benign Het
Gemin5 C T 11: 58,125,121 R1352Q probably benign Het
Gm4969 A G 7: 19,102,375 probably benign Het
Gm9639 T C 10: 77,794,691 probably benign Het
Gm973 C A 1: 59,634,092 Q160K unknown Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Grid2 A T 6: 64,076,909 Q364L possibly damaging Het
Kcnn2 T G 18: 45,592,377 S313R probably damaging Het
Kera T C 10: 97,608,952 Y58H probably damaging Het
Mtfr2 T C 10: 20,354,116 L105P probably benign Het
Myom2 A G 8: 15,084,531 T445A probably benign Het
Olfr1394 A G 11: 49,160,412 R133G possibly damaging Het
Olfr905 T A 9: 38,473,239 L164Q probably damaging Het
Pcdha12 T C 18: 37,020,276 L16P probably benign Het
Pcdhb10 T C 18: 37,413,118 Y416H probably damaging Het
Pde8b T C 13: 95,086,834 Y304C possibly damaging Het
Pkd1 T C 17: 24,578,501 I2605T possibly damaging Het
Pnn T C 12: 59,070,299 probably null Het
Ppa1 G A 10: 61,661,017 G95S probably damaging Het
Rapgef4 G T 2: 72,239,125 A730S probably damaging Het
Scap A G 9: 110,384,647 Y1226C probably damaging Het
Scn2a A T 2: 65,682,109 T197S probably benign Het
Slc2a6 GCTTCC GC 2: 27,026,035 probably null Het
Slc8a3 T C 12: 81,314,755 Y430C probably benign Het
Tead3 T C 17: 28,341,532 T33A probably benign Het
Tep1 T A 14: 50,850,705 I792F possibly damaging Het
Trpm2 A T 10: 77,935,891 I638N probably damaging Het
Tuba1c A G 15: 99,037,312 D218G probably benign Het
Tut1 T C 19: 8,966,018 L823P probably damaging Het
Umodl1 C T 17: 30,999,123 A1228V probably damaging Het
Vmn1r235 T A 17: 21,261,865 F151I probably benign Het
Vmn2r45 T A 7: 8,483,220 K356N probably benign Het
Zfp318 T A 17: 46,400,043 N897K probably damaging Het
Other mutations in Tubgcp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Tubgcp4 APN 2 121178701 missense probably damaging 0.99
IGL01112:Tubgcp4 APN 2 121173601 missense probably benign 0.10
IGL01149:Tubgcp4 APN 2 121184783 missense probably null 0.01
IGL01869:Tubgcp4 APN 2 121175788 missense possibly damaging 0.95
IGL01873:Tubgcp4 APN 2 121188184 critical splice donor site probably null
IGL01888:Tubgcp4 APN 2 121184747 missense probably benign 0.15
IGL03060:Tubgcp4 APN 2 121176590 splice site probably benign
IGL03333:Tubgcp4 APN 2 121196173 unclassified probably null
FR4589:Tubgcp4 UTSW 2 121175463 critical splice donor site probably benign
G5030:Tubgcp4 UTSW 2 121184334 missense probably damaging 1.00
R0482:Tubgcp4 UTSW 2 121175374 missense probably benign 0.02
R0512:Tubgcp4 UTSW 2 121175419 missense probably benign 0.06
R1433:Tubgcp4 UTSW 2 121175424 nonsense probably null
R1488:Tubgcp4 UTSW 2 121176550 missense possibly damaging 0.50
R1699:Tubgcp4 UTSW 2 121189893 nonsense probably null
R1760:Tubgcp4 UTSW 2 121189471 critical splice donor site probably null
R1935:Tubgcp4 UTSW 2 121178666 splice site probably benign
R2249:Tubgcp4 UTSW 2 121183629 missense possibly damaging 0.86
R4093:Tubgcp4 UTSW 2 121195477 missense probably benign 0.01
R4422:Tubgcp4 UTSW 2 121189401 nonsense probably null
R4433:Tubgcp4 UTSW 2 121184473 missense probably benign 0.01
R4541:Tubgcp4 UTSW 2 121195426 missense probably benign 0.01
R4670:Tubgcp4 UTSW 2 121173665 nonsense probably null
R4873:Tubgcp4 UTSW 2 121184849 intron probably benign
R4877:Tubgcp4 UTSW 2 121189862 missense probably benign
R5044:Tubgcp4 UTSW 2 121173580 missense probably damaging 1.00
R5436:Tubgcp4 UTSW 2 121188136 missense probably damaging 1.00
R5436:Tubgcp4 UTSW 2 121194182 missense probably benign 0.01
R5566:Tubgcp4 UTSW 2 121184770 missense possibly damaging 0.61
R6110:Tubgcp4 UTSW 2 121194108 missense probably benign 0.02
R6700:Tubgcp4 UTSW 2 121189848 missense probably benign 0.11
R6980:Tubgcp4 UTSW 2 121195465 missense probably benign 0.28
R7338:Tubgcp4 UTSW 2 121193984 missense probably benign 0.02
R7388:Tubgcp4 UTSW 2 121189966 critical splice donor site probably null
R7410:Tubgcp4 UTSW 2 121184409 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCACTCACTAGAGAGGTGAC -3'
(R):5'- TTTCCACTTAAAATGCCAAGCC -3'

Sequencing Primer
(F):5'- CAGAGGAATCCCTGTGTCTG -3'
(R):5'- AGAACAGCAGACCCTTTTCTG -3'
Posted On2019-05-13