Incidental Mutation 'R6999:Chrnb2'
ID544382
Institutional Source Beutler Lab
Gene Symbol Chrnb2
Ensembl Gene ENSMUSG00000027950
Gene Namecholinergic receptor, nicotinic, beta polypeptide 2 (neuronal)
SynonymsC030030P04Rik, Acrb2, Acrb-2, [b]2-nAchR
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.360) question?
Stock #R6999 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location89746195-89764632 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 89761315 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 231 (R231H)
Ref Sequence ENSEMBL: ENSMUSP00000143441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029562] [ENSMUST00000200558]
Predicted Effect probably benign
Transcript: ENSMUST00000029562
AA Change: R231H

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000029562
Gene: ENSMUSG00000027950
AA Change: R231H

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 29 234 5.6e-75 PFAM
Pfam:Neur_chan_memb 241 477 1.7e-86 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000200558
AA Change: R231H

PolyPhen 2 Score 0.710 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000143441
Gene: ENSMUSG00000027950
AA Change: R231H

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Neur_chan_LBD 29 234 1.5e-71 PFAM
Pfam:Neur_chan_memb 241 454 4.8e-61 PFAM
low complexity region 657 666 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neuronal acetylcholine receptors are homo- or heteropentameric complexes composed of homologous alpha and beta subunits. They belong to a superfamily of ligand-gated ion channels which allow the flow of sodium and potassium across the plasma membrane in response to ligands such as acetylcholine and nicotine. This gene encodes one of several beta subunits. Mutations in this gene are associated with autosomal dominant nocturnal frontal lobe epilepsy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations have impaired responses to nicotine, but show improved passive avoidance behavior. With age, mutants show more neurodegeneration and alterations of the visual system, with decreased cortical visual acuity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 G A 1: 71,317,162 Q629* probably null Het
Acss3 C A 10: 107,053,501 G153C probably damaging Het
Alpk2 A G 18: 65,304,513 S1270P probably damaging Het
Ankrd10 A T 8: 11,619,106 L215Q probably damaging Het
Ankrd6 A G 4: 32,823,459 S188P probably benign Het
Brinp2 A G 1: 158,251,305 M316T probably benign Het
Bsn A G 9: 108,113,433 S1707P probably benign Het
C2cd4b C T 9: 67,760,289 A189V probably benign Het
Camk2b C T 11: 5,972,321 R556H probably damaging Het
Cfap126 A G 1: 171,126,164 D101G possibly damaging Het
Chd5 A T 4: 152,374,434 I1085F probably damaging Het
Chp2 A G 7: 122,221,869 E151G probably damaging Het
Chrd A G 16: 20,735,652 T370A probably benign Het
Crisp4 T A 1: 18,137,035 I10F possibly damaging Het
Csnka2ip T A 16: 64,478,570 H477L unknown Het
Ctu1 T A 7: 43,675,238 F34I probably damaging Het
Dctn1 T A 6: 83,191,281 S407T possibly damaging Het
E330021D16Rik T C 6: 136,401,274 N186S probably benign Het
Ech1 T C 7: 28,830,264 F191L probably benign Het
Enpp3 T C 10: 24,808,166 D60G probably damaging Het
Epha6 T C 16: 60,425,170 Y222C possibly damaging Het
Eppk1 A T 15: 76,109,223 W1153R probably benign Het
Fbxo4 C T 15: 3,977,955 D76N probably damaging Het
Fndc7 G A 3: 108,876,648 A215V probably benign Het
Gemin5 C T 11: 58,125,121 R1352Q probably benign Het
Gm4969 A G 7: 19,102,375 probably benign Het
Gm9639 T C 10: 77,794,691 probably benign Het
Gm973 C A 1: 59,634,092 Q160K unknown Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Grid2 A T 6: 64,076,909 Q364L possibly damaging Het
Kcnn2 T G 18: 45,592,377 S313R probably damaging Het
Kera T C 10: 97,608,952 Y58H probably damaging Het
Mtfr2 T C 10: 20,354,116 L105P probably benign Het
Myom2 A G 8: 15,084,531 T445A probably benign Het
Olfr1394 A G 11: 49,160,412 R133G possibly damaging Het
Olfr905 T A 9: 38,473,239 L164Q probably damaging Het
Pcdha12 T C 18: 37,020,276 L16P probably benign Het
Pcdhb10 T C 18: 37,413,118 Y416H probably damaging Het
Pde8b T C 13: 95,086,834 Y304C possibly damaging Het
Pkd1 T C 17: 24,578,501 I2605T possibly damaging Het
Pnn T C 12: 59,070,299 probably null Het
Ppa1 G A 10: 61,661,017 G95S probably damaging Het
Rapgef4 G T 2: 72,239,125 A730S probably damaging Het
Scap A G 9: 110,384,647 Y1226C probably damaging Het
Scn2a A T 2: 65,682,109 T197S probably benign Het
Slc2a6 GCTTCC GC 2: 27,026,035 probably null Het
Slc8a3 T C 12: 81,314,755 Y430C probably benign Het
Tead3 T C 17: 28,341,532 T33A probably benign Het
Tep1 T A 14: 50,850,705 I792F possibly damaging Het
Trpm2 A T 10: 77,935,891 I638N probably damaging Het
Tuba1c A G 15: 99,037,312 D218G probably benign Het
Tubgcp4 T A 2: 121,192,297 W495R probably damaging Het
Tut1 T C 19: 8,966,018 L823P probably damaging Het
Umodl1 C T 17: 30,999,123 A1228V probably damaging Het
Vmn1r235 T A 17: 21,261,865 F151I probably benign Het
Vmn2r45 T A 7: 8,483,220 K356N probably benign Het
Zfp318 T A 17: 46,400,043 N897K probably damaging Het
Other mutations in Chrnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03108:Chrnb2 APN 3 89763374 splice site probably benign
IGL03117:Chrnb2 APN 3 89763245 missense probably damaging 1.00
IGL03391:Chrnb2 APN 3 89760877 missense probably damaging 0.98
R0131:Chrnb2 UTSW 3 89764406 start codon destroyed probably null 0.01
R0131:Chrnb2 UTSW 3 89764406 start codon destroyed probably null 0.01
R0132:Chrnb2 UTSW 3 89764406 start codon destroyed probably null 0.01
R1726:Chrnb2 UTSW 3 89761202 missense probably damaging 1.00
R2095:Chrnb2 UTSW 3 89761437 missense probably benign 0.01
R2124:Chrnb2 UTSW 3 89769341 unclassified probably benign
R3548:Chrnb2 UTSW 3 89761591 missense probably benign 0.04
R4212:Chrnb2 UTSW 3 89761544 missense probably damaging 1.00
R4902:Chrnb2 UTSW 3 89760941 missense probably damaging 1.00
R6307:Chrnb2 UTSW 3 89761524 missense probably damaging 1.00
R6751:Chrnb2 UTSW 3 89761576 missense probably damaging 1.00
R7318:Chrnb2 UTSW 3 89763367 critical splice acceptor site probably null
R7826:Chrnb2 UTSW 3 89763243 missense probably damaging 1.00
R8025:Chrnb2 UTSW 3 89761342 missense probably damaging 1.00
R8094:Chrnb2 UTSW 3 89761391 missense probably damaging 1.00
R8143:Chrnb2 UTSW 3 89747323 missense unknown
R8739:Chrnb2 UTSW 3 89762439 missense probably damaging 1.00
R8809:Chrnb2 UTSW 3 89757150 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGTGAACATGAGGTACTTTCCC -3'
(R):5'- ATGAAGTTCCGCTCCTGGAC -3'

Sequencing Primer
(F):5'- ATGAGGTACTTTCCCACCAGCG -3'
(R):5'- CCTACGACCGCACTGAGATTG -3'
Posted On2019-05-13