Incidental Mutation 'R6999:Ech1'
ID544391
Institutional Source Beutler Lab
Gene Symbol Ech1
Ensembl Gene ENSMUSG00000053898
Gene Nameenoyl coenzyme A hydratase 1, peroxisomal
Synonymsdienoyl-CoA isomerase
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6999 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location28825217-28832247 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28830264 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 191 (F191L)
Ref Sequence ENSEMBL: ENSMUSP00000066092 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066264] [ENSMUST00000066723] [ENSMUST00000132376] [ENSMUST00000151547] [ENSMUST00000208971]
Predicted Effect probably benign
Transcript: ENSMUST00000066264
AA Change: F191L

PolyPhen 2 Score 0.282 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000066092
Gene: ENSMUSG00000053898
AA Change: F191L

DomainStartEndE-ValueType
Pfam:ECH_1 61 321 7.2e-50 PFAM
Pfam:ECH_2 66 258 9.6e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066723
SMART Domains Protein: ENSMUSP00000066461
Gene: ENSMUSG00000053964

DomainStartEndE-ValueType
GLECT 17 150 1.24e-59 SMART
Gal-bind_lectin 23 149 1.49e-59 SMART
low complexity region 151 162 N/A INTRINSIC
GLECT 196 326 1.49e-53 SMART
Gal-bind_lectin 202 326 2.02e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132376
AA Change: F41L

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000116992
Gene: ENSMUSG00000053898
AA Change: F41L

DomainStartEndE-ValueType
Pfam:ECH 26 166 2.1e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151547
SMART Domains Protein: ENSMUSP00000141005
Gene: ENSMUSG00000053964

DomainStartEndE-ValueType
Gal-bind_lectin 1 109 4e-45 SMART
GLECT 1 110 2.3e-38 SMART
low complexity region 111 122 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208971
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hydratase/isomerase superfamily. The gene product shows high sequence similarity to enoyl-coenzyme A (CoA) hydratases of several species, particularly within a conserved domain characteristic of these proteins. The encoded protein, which contains a C-terminal peroxisomal targeting sequence, localizes to the peroxisome. The rat ortholog, which localizes to the matrix of both the peroxisome and mitochondria, can isomerize 3-trans,5-cis-dienoyl-CoA to 2-trans,4-trans-dienoyl-CoA, indicating that it is a delta3,5-delta2,4-dienoyl-CoA isomerase. This enzyme functions in the auxiliary step of the fatty acid beta-oxidation pathway. Expression of the rat gene is induced by peroxisome proliferators. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 G A 1: 71,317,162 Q629* probably null Het
Acss3 C A 10: 107,053,501 G153C probably damaging Het
Alpk2 A G 18: 65,304,513 S1270P probably damaging Het
Ankrd10 A T 8: 11,619,106 L215Q probably damaging Het
Ankrd6 A G 4: 32,823,459 S188P probably benign Het
Brinp2 A G 1: 158,251,305 M316T probably benign Het
Bsn A G 9: 108,113,433 S1707P probably benign Het
C2cd4b C T 9: 67,760,289 A189V probably benign Het
Camk2b C T 11: 5,972,321 R556H probably damaging Het
Cfap126 A G 1: 171,126,164 D101G possibly damaging Het
Chd5 A T 4: 152,374,434 I1085F probably damaging Het
Chp2 A G 7: 122,221,869 E151G probably damaging Het
Chrd A G 16: 20,735,652 T370A probably benign Het
Chrnb2 C T 3: 89,761,315 R231H possibly damaging Het
Crisp4 T A 1: 18,137,035 I10F possibly damaging Het
Csnka2ip T A 16: 64,478,570 H477L unknown Het
Ctu1 T A 7: 43,675,238 F34I probably damaging Het
Dctn1 T A 6: 83,191,281 S407T possibly damaging Het
E330021D16Rik T C 6: 136,401,274 N186S probably benign Het
Enpp3 T C 10: 24,808,166 D60G probably damaging Het
Epha6 T C 16: 60,425,170 Y222C possibly damaging Het
Eppk1 A T 15: 76,109,223 W1153R probably benign Het
Fbxo4 C T 15: 3,977,955 D76N probably damaging Het
Fndc7 G A 3: 108,876,648 A215V probably benign Het
Gemin5 C T 11: 58,125,121 R1352Q probably benign Het
Gm4969 A G 7: 19,102,375 probably benign Het
Gm9639 T C 10: 77,794,691 probably benign Het
Gm973 C A 1: 59,634,092 Q160K unknown Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Grid2 A T 6: 64,076,909 Q364L possibly damaging Het
Kcnn2 T G 18: 45,592,377 S313R probably damaging Het
Kera T C 10: 97,608,952 Y58H probably damaging Het
Mtfr2 T C 10: 20,354,116 L105P probably benign Het
Myom2 A G 8: 15,084,531 T445A probably benign Het
Olfr1394 A G 11: 49,160,412 R133G possibly damaging Het
Olfr905 T A 9: 38,473,239 L164Q probably damaging Het
Pcdha12 T C 18: 37,020,276 L16P probably benign Het
Pcdhb10 T C 18: 37,413,118 Y416H probably damaging Het
Pde8b T C 13: 95,086,834 Y304C possibly damaging Het
Pkd1 T C 17: 24,578,501 I2605T possibly damaging Het
Pnn T C 12: 59,070,299 probably null Het
Ppa1 G A 10: 61,661,017 G95S probably damaging Het
Rapgef4 G T 2: 72,239,125 A730S probably damaging Het
Scap A G 9: 110,384,647 Y1226C probably damaging Het
Scn2a A T 2: 65,682,109 T197S probably benign Het
Slc2a6 GCTTCC GC 2: 27,026,035 probably null Het
Slc8a3 T C 12: 81,314,755 Y430C probably benign Het
Tead3 T C 17: 28,341,532 T33A probably benign Het
Tep1 T A 14: 50,850,705 I792F possibly damaging Het
Trpm2 A T 10: 77,935,891 I638N probably damaging Het
Tuba1c A G 15: 99,037,312 D218G probably benign Het
Tubgcp4 T A 2: 121,192,297 W495R probably damaging Het
Tut1 T C 19: 8,966,018 L823P probably damaging Het
Umodl1 C T 17: 30,999,123 A1228V probably damaging Het
Vmn1r235 T A 17: 21,261,865 F151I probably benign Het
Vmn2r45 T A 7: 8,483,220 K356N probably benign Het
Zfp318 T A 17: 46,400,043 N897K probably damaging Het
Other mutations in Ech1
AlleleSourceChrCoordTypePredicted EffectPPH Score
pudgy UTSW 7 28830338 splice site probably null
R1640:Ech1 UTSW 7 28831839 missense probably damaging 1.00
R1797:Ech1 UTSW 7 28831863 missense probably damaging 1.00
R3612:Ech1 UTSW 7 28830243 missense probably damaging 1.00
R4395:Ech1 UTSW 7 28826246 missense probably damaging 1.00
R4698:Ech1 UTSW 7 28832053 missense probably benign 0.03
R6217:Ech1 UTSW 7 28831836 missense possibly damaging 0.91
R6396:Ech1 UTSW 7 28830338 splice site probably null
R6427:Ech1 UTSW 7 28825885 missense probably benign 0.00
R6514:Ech1 UTSW 7 28826015 missense possibly damaging 0.91
R6681:Ech1 UTSW 7 28830338 splice site probably null
R7448:Ech1 UTSW 7 28826198 missense probably damaging 1.00
R7544:Ech1 UTSW 7 28825967 missense probably benign
R8104:Ech1 UTSW 7 28825303 unclassified probably benign
R8334:Ech1 UTSW 7 28831823 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTAATCAGTGGCCACCTCTTG -3'
(R):5'- TGTGGAGACTACCAGCTGAG -3'

Sequencing Primer
(F):5'- CTCTTGGGCGCCAACTAGTTG -3'
(R):5'- GAGACTACCAGCTGAGCCTCTC -3'
Posted On2019-05-13