Incidental Mutation 'R6999:Enpp3'
ID 544401
Institutional Source Beutler Lab
Gene Symbol Enpp3
Ensembl Gene ENSMUSG00000019989
Gene Name ectonucleotide pyrophosphatase/phosphodiesterase 3
Synonyms CD203c
MMRRC Submission 045104-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.202) question?
Stock # R6999 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 24649712-24712093 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 24684064 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 60 (D60G)
Ref Sequence ENSEMBL: ENSMUSP00000151371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020169] [ENSMUST00000217903] [ENSMUST00000219342]
AlphaFold Q6DYE8
Predicted Effect probably damaging
Transcript: ENSMUST00000020169
AA Change: D225G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020169
Gene: ENSMUSG00000019989
AA Change: D225G

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
SO 50 93 1.99e-13 SMART
SO 94 137 7.66e-15 SMART
Pfam:Phosphodiest 161 485 1.7e-87 PFAM
Blast:Endonuclease_NS 543 599 9e-15 BLAST
Endonuclease_NS 626 847 5.41e-16 SMART
NUC 627 856 1.54e-92 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000217903
Predicted Effect probably damaging
Transcript: ENSMUST00000219342
AA Change: D60G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a series of ectoenzymes that are involved in hydrolysis of extracellular nucleotides. These ectoenzymes possess ATPase and ATP pyrophosphatase activities and are type II transmembrane proteins. Expression of the related rat mRNA has been found in a subset of immature glial cells and in the alimentary tract. The corresponding rat protein has been detected in the pancreas, small intestine, colon, and liver. The human mRNA is expressed in glioma cells, prostate, and uterus. Expression of the human protein has been detected in uterus, basophils, and mast cells. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knockout allele exhibit increased numbers of basophils and mast cells with increased susceptibility to chronic allergic responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 G A 1: 71,356,321 (GRCm39) Q629* probably null Het
Acss3 C A 10: 106,889,362 (GRCm39) G153C probably damaging Het
Alpk2 A G 18: 65,437,584 (GRCm39) S1270P probably damaging Het
Ankrd10 A T 8: 11,669,106 (GRCm39) L215Q probably damaging Het
Ankrd6 A G 4: 32,823,459 (GRCm39) S188P probably benign Het
Brinp2 A G 1: 158,078,875 (GRCm39) M316T probably benign Het
Bsn A G 9: 107,990,632 (GRCm39) S1707P probably benign Het
C2cd4b C T 9: 67,667,571 (GRCm39) A189V probably benign Het
Camk2b C T 11: 5,922,321 (GRCm39) R556H probably damaging Het
Cfap126 A G 1: 170,953,733 (GRCm39) D101G possibly damaging Het
Chd5 A T 4: 152,458,891 (GRCm39) I1085F probably damaging Het
Chp2 A G 7: 121,821,092 (GRCm39) E151G probably damaging Het
Chrd A G 16: 20,554,402 (GRCm39) T370A probably benign Het
Chrnb2 C T 3: 89,668,622 (GRCm39) R231H possibly damaging Het
Crisp4 T A 1: 18,207,259 (GRCm39) I10F possibly damaging Het
Csnka2ip T A 16: 64,298,933 (GRCm39) H477L unknown Het
Ctu1 T A 7: 43,324,662 (GRCm39) F34I probably damaging Het
Dctn1 T A 6: 83,168,263 (GRCm39) S407T possibly damaging Het
Ech1 T C 7: 28,529,689 (GRCm39) F191L probably benign Het
Epha6 T C 16: 60,245,533 (GRCm39) Y222C possibly damaging Het
Eppk1 A T 15: 75,993,423 (GRCm39) W1153R probably benign Het
Fbxo4 C T 15: 4,007,437 (GRCm39) D76N probably damaging Het
Fndc7 G A 3: 108,783,964 (GRCm39) A215V probably benign Het
Gemin5 C T 11: 58,015,947 (GRCm39) R1352Q probably benign Het
Gm9639 T C 10: 77,630,525 (GRCm39) probably benign Het
Gm973 C A 1: 59,673,251 (GRCm39) Q160K unknown Het
Gpatch2l G A 12: 86,290,958 (GRCm39) R47H probably damaging Het
Grid2 A T 6: 64,053,893 (GRCm39) Q364L possibly damaging Het
Kcnn2 T G 18: 45,725,444 (GRCm39) S313R probably damaging Het
Kera T C 10: 97,444,814 (GRCm39) Y58H probably damaging Het
Meiosin A G 7: 18,836,300 (GRCm39) probably benign Het
Mtfr2 T C 10: 20,229,862 (GRCm39) L105P probably benign Het
Myom2 A G 8: 15,134,531 (GRCm39) T445A probably benign Het
Or2o1 A G 11: 49,051,239 (GRCm39) R133G possibly damaging Het
Or8b1c T A 9: 38,384,535 (GRCm39) L164Q probably damaging Het
Pcdha12 T C 18: 37,153,329 (GRCm39) L16P probably benign Het
Pcdhb10 T C 18: 37,546,171 (GRCm39) Y416H probably damaging Het
Pde8b T C 13: 95,223,342 (GRCm39) Y304C possibly damaging Het
Pkd1 T C 17: 24,797,475 (GRCm39) I2605T possibly damaging Het
Pnn T C 12: 59,117,085 (GRCm39) probably null Het
Ppa1 G A 10: 61,496,796 (GRCm39) G95S probably damaging Het
Rapgef4 G T 2: 72,069,469 (GRCm39) A730S probably damaging Het
Scap A G 9: 110,213,715 (GRCm39) Y1226C probably damaging Het
Scn2a A T 2: 65,512,453 (GRCm39) T197S probably benign Het
Slc2a6 GCTTCC GC 2: 26,916,047 (GRCm39) probably null Het
Slc8a3 T C 12: 81,361,529 (GRCm39) Y430C probably benign Het
Tead3 T C 17: 28,560,506 (GRCm39) T33A probably benign Het
Tep1 T A 14: 51,088,162 (GRCm39) I792F possibly damaging Het
Trpm2 A T 10: 77,771,725 (GRCm39) I638N probably damaging Het
Tuba1c A G 15: 98,935,193 (GRCm39) D218G probably benign Het
Tubgcp4 T A 2: 121,022,778 (GRCm39) W495R probably damaging Het
Tut1 T C 19: 8,943,382 (GRCm39) L823P probably damaging Het
Ube2q2l T C 6: 136,378,272 (GRCm39) N186S probably benign Het
Umodl1 C T 17: 31,218,097 (GRCm39) A1228V probably damaging Het
Vmn1r235 T A 17: 21,482,127 (GRCm39) F151I probably benign Het
Vmn2r45 T A 7: 8,486,219 (GRCm39) K356N probably benign Het
Zfp318 T A 17: 46,710,969 (GRCm39) N897K probably damaging Het
Other mutations in Enpp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Enpp3 APN 10 24,663,670 (GRCm39) missense probably benign 0.00
IGL00778:Enpp3 APN 10 24,674,160 (GRCm39) missense probably damaging 1.00
IGL01147:Enpp3 APN 10 24,650,805 (GRCm39) missense probably damaging 1.00
IGL01343:Enpp3 APN 10 24,681,820 (GRCm39) nonsense probably null
IGL01642:Enpp3 APN 10 24,674,167 (GRCm39) missense probably damaging 1.00
IGL01814:Enpp3 APN 10 24,667,923 (GRCm39) missense possibly damaging 0.68
IGL02083:Enpp3 APN 10 24,652,692 (GRCm39) missense probably damaging 1.00
IGL02152:Enpp3 APN 10 24,649,900 (GRCm39) missense probably damaging 1.00
IGL02186:Enpp3 APN 10 24,667,881 (GRCm39) splice site probably benign
IGL02517:Enpp3 APN 10 24,685,746 (GRCm39) splice site probably benign
IGL02956:Enpp3 APN 10 24,650,841 (GRCm39) splice site probably benign
R0017:Enpp3 UTSW 10 24,675,051 (GRCm39) splice site probably null
R0042:Enpp3 UTSW 10 24,650,722 (GRCm39) missense probably damaging 1.00
R0110:Enpp3 UTSW 10 24,652,679 (GRCm39) missense probably damaging 1.00
R0218:Enpp3 UTSW 10 24,652,767 (GRCm39) missense possibly damaging 0.80
R0403:Enpp3 UTSW 10 24,680,334 (GRCm39) missense probably damaging 1.00
R0433:Enpp3 UTSW 10 24,696,495 (GRCm39) missense probably benign 0.00
R0450:Enpp3 UTSW 10 24,652,679 (GRCm39) missense probably damaging 1.00
R0510:Enpp3 UTSW 10 24,652,679 (GRCm39) missense probably damaging 1.00
R0826:Enpp3 UTSW 10 24,671,614 (GRCm39) missense probably damaging 1.00
R1245:Enpp3 UTSW 10 24,660,851 (GRCm39) splice site probably benign
R1261:Enpp3 UTSW 10 24,650,832 (GRCm39) missense probably damaging 0.97
R1633:Enpp3 UTSW 10 24,671,680 (GRCm39) missense probably damaging 1.00
R1903:Enpp3 UTSW 10 24,654,687 (GRCm39) missense probably damaging 1.00
R1913:Enpp3 UTSW 10 24,652,669 (GRCm39) nonsense probably null
R1966:Enpp3 UTSW 10 24,683,389 (GRCm39) missense probably damaging 0.99
R2157:Enpp3 UTSW 10 24,652,776 (GRCm39) missense probably damaging 1.00
R2179:Enpp3 UTSW 10 24,681,793 (GRCm39) missense probably benign 0.00
R2380:Enpp3 UTSW 10 24,652,770 (GRCm39) missense probably benign
R2410:Enpp3 UTSW 10 24,650,716 (GRCm39) missense probably benign 0.00
R3794:Enpp3 UTSW 10 24,707,630 (GRCm39) splice site probably null
R3896:Enpp3 UTSW 10 24,653,847 (GRCm39) missense possibly damaging 0.79
R4334:Enpp3 UTSW 10 24,669,487 (GRCm39) missense probably damaging 1.00
R4569:Enpp3 UTSW 10 24,652,780 (GRCm39) missense probably damaging 1.00
R4766:Enpp3 UTSW 10 24,649,825 (GRCm39) missense probably damaging 1.00
R4951:Enpp3 UTSW 10 24,674,175 (GRCm39) missense probably damaging 1.00
R4998:Enpp3 UTSW 10 24,683,436 (GRCm39) missense probably benign 0.01
R5045:Enpp3 UTSW 10 24,652,665 (GRCm39) missense probably damaging 1.00
R5276:Enpp3 UTSW 10 24,685,814 (GRCm39) missense probably damaging 1.00
R5331:Enpp3 UTSW 10 24,684,058 (GRCm39) missense probably damaging 1.00
R5569:Enpp3 UTSW 10 24,654,719 (GRCm39) missense probably damaging 0.98
R5975:Enpp3 UTSW 10 24,650,740 (GRCm39) missense probably benign 0.37
R6117:Enpp3 UTSW 10 24,663,750 (GRCm39) missense probably damaging 1.00
R6419:Enpp3 UTSW 10 24,684,089 (GRCm39) missense probably damaging 1.00
R6677:Enpp3 UTSW 10 24,653,855 (GRCm39) missense possibly damaging 0.88
R6735:Enpp3 UTSW 10 24,683,351 (GRCm39) missense probably damaging 1.00
R6833:Enpp3 UTSW 10 24,685,768 (GRCm39) missense probably damaging 1.00
R7022:Enpp3 UTSW 10 24,702,093 (GRCm39) missense probably damaging 0.99
R7173:Enpp3 UTSW 10 24,649,945 (GRCm39) missense probably damaging 1.00
R7224:Enpp3 UTSW 10 24,652,782 (GRCm39) missense possibly damaging 0.63
R7227:Enpp3 UTSW 10 24,693,742 (GRCm39) missense unknown
R7487:Enpp3 UTSW 10 24,681,821 (GRCm39) missense probably benign 0.02
R7529:Enpp3 UTSW 10 24,674,072 (GRCm39) missense probably damaging 0.97
R7583:Enpp3 UTSW 10 24,711,990 (GRCm39) start codon destroyed probably null 0.83
R7692:Enpp3 UTSW 10 24,660,739 (GRCm39) nonsense probably null
R7962:Enpp3 UTSW 10 24,660,752 (GRCm39) missense probably damaging 1.00
R7965:Enpp3 UTSW 10 24,654,717 (GRCm39) missense possibly damaging 0.90
R8153:Enpp3 UTSW 10 24,685,777 (GRCm39) missense probably damaging 1.00
R8262:Enpp3 UTSW 10 24,653,824 (GRCm39) missense probably damaging 1.00
R8305:Enpp3 UTSW 10 24,700,827 (GRCm39) critical splice acceptor site probably null
R8393:Enpp3 UTSW 10 24,702,139 (GRCm39) missense probably damaging 1.00
R8776:Enpp3 UTSW 10 24,650,733 (GRCm39) missense probably damaging 1.00
R8776-TAIL:Enpp3 UTSW 10 24,650,733 (GRCm39) missense probably damaging 1.00
R8962:Enpp3 UTSW 10 24,696,513 (GRCm39) missense probably benign 0.12
R9047:Enpp3 UTSW 10 24,674,172 (GRCm39) missense possibly damaging 0.83
R9093:Enpp3 UTSW 10 24,671,702 (GRCm39) missense probably benign 0.00
R9117:Enpp3 UTSW 10 24,702,078 (GRCm39) missense possibly damaging 0.67
R9194:Enpp3 UTSW 10 24,675,092 (GRCm39) missense possibly damaging 0.90
R9224:Enpp3 UTSW 10 24,650,716 (GRCm39) missense probably benign 0.00
R9244:Enpp3 UTSW 10 24,654,689 (GRCm39) missense probably damaging 1.00
R9387:Enpp3 UTSW 10 24,711,990 (GRCm39) start codon destroyed probably null 0.83
R9644:Enpp3 UTSW 10 24,685,801 (GRCm39) missense probably damaging 0.98
R9658:Enpp3 UTSW 10 24,649,802 (GRCm39) makesense probably null
X0026:Enpp3 UTSW 10 24,702,140 (GRCm39) missense probably damaging 1.00
Z1176:Enpp3 UTSW 10 24,663,691 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CCATTAGAAACTACATGAATGGCG -3'
(R):5'- AGAAGCTGCGTCTTCCTGAC -3'

Sequencing Primer
(F):5'- CTCGAGTAGACTGAGAACACCG -3'
(R):5'- CCTGACACTTTAGTTTCAGATCTG -3'
Posted On 2019-05-13