Mutagenetix > Incidental Mutation

Incidental Mutation 'R6999:Enpp3'

544401

Institutional Source

Beutler Lab

Gene Symbol

Enpp3

Ensembl Gene

ENSMUSG00000019989

Gene Name

ectonucleotide pyrophosphatase/phosphodiesterase 3

Synonyms

CD203c

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.160) question?

Stock #

R6999 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

24772406-24842823 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 24808166 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 60 (D60G)

Ref Sequence

ENSEMBL: ENSMUSP00000151371 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020169] [ENSMUST00000217903] [ENSMUST00000219342]

AlphaFold

Q6DYE8

Predicted Effect

probably damaging
Transcript: ENSMUST00000020169
AA Change: D225G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000020169
Gene: ENSMUSG00000019989
AA Change: D225G

Domain	Start	End	E-Value	Type
transmembrane domain	23	45	N/A	INTRINSIC
SO	50	93	1.99e-13	SMART
SO	94	137	7.66e-15	SMART
Pfam:Phosphodiest	161	485	1.7e-87	PFAM
Blast:Endonuclease_NS	543	599	9e-15	BLAST
Endonuclease_NS	626	847	5.41e-16	SMART
NUC	627	856	1.54e-92	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000217903

Predicted Effect

probably damaging
Transcript: ENSMUST00000219342
AA Change: D60G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a series of ectoenzymes that are involved in hydrolysis of extracellular nucleotides. These ectoenzymes possess ATPase and ATP pyrophosphatase activities and are type II transmembrane proteins. Expression of the related rat mRNA has been found in a subset of immature glial cells and in the alimentary tract. The corresponding rat protein has been detected in the pancreas, small intestine, colon, and liver. The human mRNA is expressed in glioma cells, prostate, and uterus. Expression of the human protein has been detected in uterus, basophils, and mast cells. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knockout allele exhibit increased numbers of basophils and mast cells with increased susceptibility to chronic allergic responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	G	A	1: 71,317,162	Q629*	probably null	Het
Acss3	C	A	10: 107,053,501	G153C	probably damaging	Het
Alpk2	A	G	18: 65,304,513	S1270P	probably damaging	Het
Ankrd10	A	T	8: 11,619,106	L215Q	probably damaging	Het
Ankrd6	A	G	4: 32,823,459	S188P	probably benign	Het
Brinp2	A	G	1: 158,251,305	M316T	probably benign	Het
Bsn	A	G	9: 108,113,433	S1707P	probably benign	Het
C2cd4b	C	T	9: 67,760,289	A189V	probably benign	Het
Camk2b	C	T	11: 5,972,321	R556H	probably damaging	Het
Cfap126	A	G	1: 171,126,164	D101G	possibly damaging	Het
Chd5	A	T	4: 152,374,434	I1085F	probably damaging	Het
Chp2	A	G	7: 122,221,869	E151G	probably damaging	Het
Chrd	A	G	16: 20,735,652	T370A	probably benign	Het
Chrnb2	C	T	3: 89,761,315	R231H	possibly damaging	Het
Crisp4	T	A	1: 18,137,035	I10F	possibly damaging	Het
Csnka2ip	T	A	16: 64,478,570	H477L	unknown	Het
Ctu1	T	A	7: 43,675,238	F34I	probably damaging	Het
Dctn1	T	A	6: 83,191,281	S407T	possibly damaging	Het
E330021D16Rik	T	C	6: 136,401,274	N186S	probably benign	Het
Ech1	T	C	7: 28,830,264	F191L	probably benign	Het
Epha6	T	C	16: 60,425,170	Y222C	possibly damaging	Het
Eppk1	A	T	15: 76,109,223	W1153R	probably benign	Het
Fbxo4	C	T	15: 3,977,955	D76N	probably damaging	Het
Fndc7	G	A	3: 108,876,648	A215V	probably benign	Het
Gemin5	C	T	11: 58,125,121	R1352Q	probably benign	Het
Gm4969	A	G	7: 19,102,375		probably benign	Het
Gm9639	T	C	10: 77,794,691		probably benign	Het
Gm973	C	A	1: 59,634,092	Q160K	unknown	Het
Gpatch2l	G	A	12: 86,244,184	R47H	probably damaging	Het
Grid2	A	T	6: 64,076,909	Q364L	possibly damaging	Het
Kcnn2	T	G	18: 45,592,377	S313R	probably damaging	Het
Kera	T	C	10: 97,608,952	Y58H	probably damaging	Het
Mtfr2	T	C	10: 20,354,116	L105P	probably benign	Het
Myom2	A	G	8: 15,084,531	T445A	probably benign	Het
Olfr1394	A	G	11: 49,160,412	R133G	possibly damaging	Het
Olfr905	T	A	9: 38,473,239	L164Q	probably damaging	Het
Pcdha12	T	C	18: 37,020,276	L16P	probably benign	Het
Pcdhb10	T	C	18: 37,413,118	Y416H	probably damaging	Het
Pde8b	T	C	13: 95,086,834	Y304C	possibly damaging	Het
Pkd1	T	C	17: 24,578,501	I2605T	possibly damaging	Het
Pnn	T	C	12: 59,070,299		probably null	Het
Ppa1	G	A	10: 61,661,017	G95S	probably damaging	Het
Rapgef4	G	T	2: 72,239,125	A730S	probably damaging	Het
Scap	A	G	9: 110,384,647	Y1226C	probably damaging	Het
Scn2a	A	T	2: 65,682,109	T197S	probably benign	Het
Slc2a6	GCTTCC	GC	2: 27,026,035		probably null	Het
Slc8a3	T	C	12: 81,314,755	Y430C	probably benign	Het
Tead3	T	C	17: 28,341,532	T33A	probably benign	Het
Tep1	T	A	14: 50,850,705	I792F	possibly damaging	Het
Trpm2	A	T	10: 77,935,891	I638N	probably damaging	Het
Tuba1c	A	G	15: 99,037,312	D218G	probably benign	Het
Tubgcp4	T	A	2: 121,192,297	W495R	probably damaging	Het
Tut1	T	C	19: 8,966,018	L823P	probably damaging	Het
Umodl1	C	T	17: 30,999,123	A1228V	probably damaging	Het
Vmn1r235	T	A	17: 21,261,865	F151I	probably benign	Het
Vmn2r45	T	A	7: 8,483,220	K356N	probably benign	Het
Zfp318	T	A	17: 46,400,043	N897K	probably damaging	Het

Other mutations in Enpp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00519:Enpp3	APN	10	24787772	missense	probably benign	0.00
IGL00778:Enpp3	APN	10	24798262	missense	probably damaging	1.00
IGL01147:Enpp3	APN	10	24774907	missense	probably damaging	1.00
IGL01343:Enpp3	APN	10	24805922	nonsense	probably null
IGL01642:Enpp3	APN	10	24798269	missense	probably damaging	1.00
IGL01814:Enpp3	APN	10	24792025	missense	possibly damaging	0.68
IGL02083:Enpp3	APN	10	24776794	missense	probably damaging	1.00
IGL02152:Enpp3	APN	10	24774002	missense	probably damaging	1.00
IGL02186:Enpp3	APN	10	24791983	splice site	probably benign
IGL02517:Enpp3	APN	10	24809848	splice site	probably benign
IGL02956:Enpp3	APN	10	24774943	splice site	probably benign
R0017:Enpp3	UTSW	10	24799153	splice site	probably null
R0042:Enpp3	UTSW	10	24774824	missense	probably damaging	1.00
R0110:Enpp3	UTSW	10	24776781	missense	probably damaging	1.00
R0218:Enpp3	UTSW	10	24776869	missense	possibly damaging	0.80
R0403:Enpp3	UTSW	10	24804436	missense	probably damaging	1.00
R0433:Enpp3	UTSW	10	24820597	missense	probably benign	0.00
R0450:Enpp3	UTSW	10	24776781	missense	probably damaging	1.00
R0510:Enpp3	UTSW	10	24776781	missense	probably damaging	1.00
R0826:Enpp3	UTSW	10	24795716	missense	probably damaging	1.00
R1245:Enpp3	UTSW	10	24784953	splice site	probably benign
R1261:Enpp3	UTSW	10	24774934	missense	probably damaging	0.97
R1633:Enpp3	UTSW	10	24795782	missense	probably damaging	1.00
R1903:Enpp3	UTSW	10	24778789	missense	probably damaging	1.00
R1913:Enpp3	UTSW	10	24776771	nonsense	probably null
R1966:Enpp3	UTSW	10	24807491	missense	probably damaging	0.99
R2157:Enpp3	UTSW	10	24776878	missense	probably damaging	1.00
R2179:Enpp3	UTSW	10	24805895	missense	probably benign	0.00
R2380:Enpp3	UTSW	10	24776872	missense	probably benign
R2410:Enpp3	UTSW	10	24774818	missense	probably benign	0.00
R3794:Enpp3	UTSW	10	24831732	splice site	probably null
R3896:Enpp3	UTSW	10	24777949	missense	possibly damaging	0.79
R4334:Enpp3	UTSW	10	24793589	missense	probably damaging	1.00
R4569:Enpp3	UTSW	10	24776882	missense	probably damaging	1.00
R4766:Enpp3	UTSW	10	24773927	missense	probably damaging	1.00
R4951:Enpp3	UTSW	10	24798277	missense	probably damaging	1.00
R4998:Enpp3	UTSW	10	24807538	missense	probably benign	0.01
R5045:Enpp3	UTSW	10	24776767	missense	probably damaging	1.00
R5276:Enpp3	UTSW	10	24809916	missense	probably damaging	1.00
R5331:Enpp3	UTSW	10	24808160	missense	probably damaging	1.00
R5569:Enpp3	UTSW	10	24778821	missense	probably damaging	0.98
R5975:Enpp3	UTSW	10	24774842	missense	probably benign	0.37
R6117:Enpp3	UTSW	10	24787852	missense	probably damaging	1.00
R6419:Enpp3	UTSW	10	24808191	missense	probably damaging	1.00
R6677:Enpp3	UTSW	10	24777957	missense	possibly damaging	0.88
R6735:Enpp3	UTSW	10	24807453	missense	probably damaging	1.00
R6833:Enpp3	UTSW	10	24809870	missense	probably damaging	1.00
R7022:Enpp3	UTSW	10	24826195	missense	probably damaging	0.99
R7173:Enpp3	UTSW	10	24774047	missense	probably damaging	1.00
R7224:Enpp3	UTSW	10	24776884	missense	possibly damaging	0.63
R7227:Enpp3	UTSW	10	24817844	missense	unknown
R7487:Enpp3	UTSW	10	24805923	missense	probably benign	0.02
R7529:Enpp3	UTSW	10	24798174	missense	probably damaging	0.97
R7583:Enpp3	UTSW	10	24836092	start codon destroyed	probably null	0.83
R7692:Enpp3	UTSW	10	24784841	nonsense	probably null
R7962:Enpp3	UTSW	10	24784854	missense	probably damaging	1.00
R7965:Enpp3	UTSW	10	24778819	missense	possibly damaging	0.90
R8153:Enpp3	UTSW	10	24809879	missense	probably damaging	1.00
R8262:Enpp3	UTSW	10	24777926	missense	probably damaging	1.00
R8305:Enpp3	UTSW	10	24824929	critical splice acceptor site	probably null
R8393:Enpp3	UTSW	10	24826241	missense	probably damaging	1.00
R8776:Enpp3	UTSW	10	24774835	missense	probably damaging	1.00
R8776-TAIL:Enpp3	UTSW	10	24774835	missense	probably damaging	1.00
R8962:Enpp3	UTSW	10	24820615	missense	probably benign	0.12
R9047:Enpp3	UTSW	10	24798274	missense	possibly damaging	0.83
R9093:Enpp3	UTSW	10	24795804	missense	probably benign	0.00
R9117:Enpp3	UTSW	10	24826180	missense	possibly damaging	0.67
R9194:Enpp3	UTSW	10	24799194	missense	possibly damaging	0.90
R9224:Enpp3	UTSW	10	24774818	missense	probably benign	0.00
R9244:Enpp3	UTSW	10	24778791	missense	probably damaging	1.00
R9387:Enpp3	UTSW	10	24836092	start codon destroyed	probably null	0.83
R9644:Enpp3	UTSW	10	24809903	missense	probably damaging	0.98
R9658:Enpp3	UTSW	10	24773904	makesense	probably null
X0026:Enpp3	UTSW	10	24826242	missense	probably damaging	1.00
Z1176:Enpp3	UTSW	10	24787793	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CCATTAGAAACTACATGAATGGCG -3'
(R):5'- AGAAGCTGCGTCTTCCTGAC -3'

Sequencing Primer
(F):5'- CTCGAGTAGACTGAGAACACCG -3'
(R):5'- CCTGACACTTTAGTTTCAGATCTG -3'

Posted On

2019-05-13