Incidental Mutation 'R6999:Epha6'
ID 544419
Institutional Source Beutler Lab
Gene Symbol Epha6
Ensembl Gene ENSMUSG00000055540
Gene Name Eph receptor A6
Synonyms m-ehk2, Hek12, Ehk2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6999 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 59653483-60605531 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 60425170 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 222 (Y222C)
Ref Sequence ENSEMBL: ENSMUSP00000066734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068860]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000068860
AA Change: Y222C

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000066734
Gene: ENSMUSG00000055540
AA Change: Y222C

DomainStartEndE-ValueType
low complexity region 4 37 N/A INTRINSIC
low complexity region 79 90 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
EPH_lbd 128 301 5.95e-125 SMART
Pfam:GCC2_GCC3 361 406 1.6e-8 PFAM
FN3 426 518 5.83e-3 SMART
FN3 537 618 2.19e-7 SMART
Pfam:EphA2_TM 644 722 1.8e-22 PFAM
TyrKc 725 1024 3.66e-122 SMART
SAM 1052 1119 1.24e-22 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display discrete learning and memory deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 G A 1: 71,317,162 Q629* probably null Het
Acss3 C A 10: 107,053,501 G153C probably damaging Het
Alpk2 A G 18: 65,304,513 S1270P probably damaging Het
Ankrd10 A T 8: 11,619,106 L215Q probably damaging Het
Ankrd6 A G 4: 32,823,459 S188P probably benign Het
Brinp2 A G 1: 158,251,305 M316T probably benign Het
Bsn A G 9: 108,113,433 S1707P probably benign Het
C2cd4b C T 9: 67,760,289 A189V probably benign Het
Camk2b C T 11: 5,972,321 R556H probably damaging Het
Cfap126 A G 1: 171,126,164 D101G possibly damaging Het
Chd5 A T 4: 152,374,434 I1085F probably damaging Het
Chp2 A G 7: 122,221,869 E151G probably damaging Het
Chrd A G 16: 20,735,652 T370A probably benign Het
Chrnb2 C T 3: 89,761,315 R231H possibly damaging Het
Crisp4 T A 1: 18,137,035 I10F possibly damaging Het
Csnka2ip T A 16: 64,478,570 H477L unknown Het
Ctu1 T A 7: 43,675,238 F34I probably damaging Het
Dctn1 T A 6: 83,191,281 S407T possibly damaging Het
E330021D16Rik T C 6: 136,401,274 N186S probably benign Het
Ech1 T C 7: 28,830,264 F191L probably benign Het
Enpp3 T C 10: 24,808,166 D60G probably damaging Het
Eppk1 A T 15: 76,109,223 W1153R probably benign Het
Fbxo4 C T 15: 3,977,955 D76N probably damaging Het
Fndc7 G A 3: 108,876,648 A215V probably benign Het
Gemin5 C T 11: 58,125,121 R1352Q probably benign Het
Gm4969 A G 7: 19,102,375 probably benign Het
Gm9639 T C 10: 77,794,691 probably benign Het
Gm973 C A 1: 59,634,092 Q160K unknown Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Grid2 A T 6: 64,076,909 Q364L possibly damaging Het
Kcnn2 T G 18: 45,592,377 S313R probably damaging Het
Kera T C 10: 97,608,952 Y58H probably damaging Het
Mtfr2 T C 10: 20,354,116 L105P probably benign Het
Myom2 A G 8: 15,084,531 T445A probably benign Het
Olfr1394 A G 11: 49,160,412 R133G possibly damaging Het
Olfr905 T A 9: 38,473,239 L164Q probably damaging Het
Pcdha12 T C 18: 37,020,276 L16P probably benign Het
Pcdhb10 T C 18: 37,413,118 Y416H probably damaging Het
Pde8b T C 13: 95,086,834 Y304C possibly damaging Het
Pkd1 T C 17: 24,578,501 I2605T possibly damaging Het
Pnn T C 12: 59,070,299 probably null Het
Ppa1 G A 10: 61,661,017 G95S probably damaging Het
Rapgef4 G T 2: 72,239,125 A730S probably damaging Het
Scap A G 9: 110,384,647 Y1226C probably damaging Het
Scn2a A T 2: 65,682,109 T197S probably benign Het
Slc2a6 GCTTCC GC 2: 27,026,035 probably null Het
Slc8a3 T C 12: 81,314,755 Y430C probably benign Het
Tead3 T C 17: 28,341,532 T33A probably benign Het
Tep1 T A 14: 50,850,705 I792F possibly damaging Het
Trpm2 A T 10: 77,935,891 I638N probably damaging Het
Tuba1c A G 15: 99,037,312 D218G probably benign Het
Tubgcp4 T A 2: 121,192,297 W495R probably damaging Het
Tut1 T C 19: 8,966,018 L823P probably damaging Het
Umodl1 C T 17: 30,999,123 A1228V probably damaging Het
Vmn1r235 T A 17: 21,261,865 F151I probably benign Het
Vmn2r45 T A 7: 8,483,220 K356N probably benign Het
Zfp318 T A 17: 46,400,043 N897K probably damaging Het
Other mutations in Epha6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Epha6 APN 16 59915962 missense probably damaging 1.00
IGL00849:Epha6 APN 16 60425111 missense possibly damaging 0.89
IGL00898:Epha6 APN 16 59775541 critical splice donor site probably null
IGL01353:Epha6 APN 16 60424895 missense probably damaging 1.00
IGL01409:Epha6 APN 16 59655737 nonsense probably null
IGL01577:Epha6 APN 16 59956926 missense possibly damaging 0.57
IGL01653:Epha6 APN 16 59839303 missense probably benign 0.05
IGL01654:Epha6 APN 16 59839303 missense probably benign 0.05
IGL01655:Epha6 APN 16 59839303 missense probably benign 0.05
IGL01657:Epha6 APN 16 59839303 missense probably benign 0.05
IGL01663:Epha6 APN 16 59775644 missense probably damaging 1.00
IGL01899:Epha6 APN 16 59839303 missense probably benign 0.05
IGL02272:Epha6 APN 16 59818937 missense probably damaging 1.00
IGL03265:Epha6 APN 16 60060231 splice site probably benign
IGL03333:Epha6 APN 16 59682688 missense probably damaging 1.00
rauwulfia UTSW 16 59682616 missense probably damaging 1.00
PIT4377001:Epha6 UTSW 16 60205552 missense probably damaging 0.98
R0505:Epha6 UTSW 16 60205732 missense possibly damaging 0.89
R1593:Epha6 UTSW 16 60424904 missense probably damaging 1.00
R1764:Epha6 UTSW 16 59775728 missense probably null 1.00
R1836:Epha6 UTSW 16 60205745 missense probably damaging 1.00
R2061:Epha6 UTSW 16 59655797 missense probably damaging 1.00
R2125:Epha6 UTSW 16 59682688 missense probably damaging 1.00
R2867:Epha6 UTSW 16 59960296 splice site probably null
R2867:Epha6 UTSW 16 59960296 splice site probably null
R3760:Epha6 UTSW 16 60220984 missense possibly damaging 0.70
R4305:Epha6 UTSW 16 60526520 splice site probably null
R4613:Epha6 UTSW 16 59666597 missense possibly damaging 0.80
R4818:Epha6 UTSW 16 59654063 missense probably damaging 0.99
R4832:Epha6 UTSW 16 59960413 missense probably damaging 0.98
R4895:Epha6 UTSW 16 59666555 missense probably benign 0.08
R5014:Epha6 UTSW 16 59666579 missense probably benign 0.00
R5316:Epha6 UTSW 16 59954720 missense probably damaging 0.99
R5403:Epha6 UTSW 16 59775570 missense probably damaging 1.00
R5417:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R5418:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R5678:Epha6 UTSW 16 59818979 missense probably damaging 1.00
R5775:Epha6 UTSW 16 59818994 missense possibly damaging 0.92
R5808:Epha6 UTSW 16 59682742 missense probably damaging 1.00
R6076:Epha6 UTSW 16 60205710 missense probably damaging 1.00
R6146:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R6212:Epha6 UTSW 16 60425356 missense possibly damaging 0.77
R6242:Epha6 UTSW 16 59682662 missense probably damaging 1.00
R6503:Epha6 UTSW 16 60205621 missense possibly damaging 0.61
R6580:Epha6 UTSW 16 59682616 missense probably damaging 1.00
R6726:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R6728:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R6798:Epha6 UTSW 16 60605064 missense possibly damaging 0.53
R6798:Epha6 UTSW 16 60605065 missense possibly damaging 0.53
R6903:Epha6 UTSW 16 60526462 missense probably benign 0.00
R7058:Epha6 UTSW 16 59682650 missense probably damaging 1.00
R7109:Epha6 UTSW 16 59682668 missense probably damaging 1.00
R7263:Epha6 UTSW 16 59775665 missense probably damaging 1.00
R7296:Epha6 UTSW 16 59915838 missense probably benign 0.00
R7343:Epha6 UTSW 16 59960430 missense probably damaging 0.98
R7443:Epha6 UTSW 16 59775625 missense possibly damaging 0.93
R7533:Epha6 UTSW 16 60205562 missense probably damaging 1.00
R7602:Epha6 UTSW 16 59775568 missense probably damaging 1.00
R7604:Epha6 UTSW 16 60205772 missense possibly damaging 0.89
R8321:Epha6 UTSW 16 59915954 missense probably damaging 1.00
R8414:Epha6 UTSW 16 60005667 missense probably damaging 1.00
R8794:Epha6 UTSW 16 60205672 missense probably benign 0.00
R8926:Epha6 UTSW 16 59839299 missense probably benign 0.11
R9166:Epha6 UTSW 16 60604875 missense probably benign 0.00
R9265:Epha6 UTSW 16 59655754 missense probably damaging 1.00
R9322:Epha6 UTSW 16 60424755 missense probably damaging 1.00
Z1188:Epha6 UTSW 16 59654090 missense probably damaging 1.00
Z1189:Epha6 UTSW 16 59654090 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGATGCATGCTCCAATATCTTG -3'
(R):5'- ATGGATGAACACAATAGGCCC -3'

Sequencing Primer
(F):5'- TGCATGCTCCAATATCTTGAAAAGCC -3'
(R):5'- TAGGCCCATACATACATACCAGG -3'
Posted On 2019-05-13