Incidental Mutation 'R0608:Gml2'
ID 54444
Institutional Source Beutler Lab
Gene Symbol Gml2
Ensembl Gene ENSMUSG00000068600
Gene Name glycosylphosphatidylinositol anchored molecule like 2
Synonyms hematopoietic cell-specific transcript, HemT, Hemt1, 1700057K19Rik
MMRRC Submission 038797-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.052) question?
Stock # R0608 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 74690920-74706720 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 74693235 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096399] [ENSMUST00000096400] [ENSMUST00000164026] [ENSMUST00000185253] [ENSMUST00000188180]
AlphaFold G5E8L7
Predicted Effect probably null
Transcript: ENSMUST00000096399
SMART Domains Protein: ENSMUSP00000094130
Gene: ENSMUSG00000068600

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
LU 47 141 2.06e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000096400
SMART Domains Protein: ENSMUSP00000094131
Gene: ENSMUSG00000068349

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
LU 47 141 2.3e-5 SMART
low complexity region 162 175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164026
SMART Domains Protein: ENSMUSP00000128174
Gene: ENSMUSG00000068349

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
LU 47 141 2.3e-5 SMART
low complexity region 162 175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185253
SMART Domains Protein: ENSMUSP00000140245
Gene: ENSMUSG00000068349

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:UPAR_LY6 49 104 3.8e-3 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186752
Predicted Effect probably null
Transcript: ENSMUST00000188180
SMART Domains Protein: ENSMUSP00000141185
Gene: ENSMUSG00000068600

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Blast:LU 47 80 2e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188458
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 A G 14: 78,748,193 (GRCm39) V1398A probably benign Het
Ampd3 C A 7: 110,394,997 (GRCm39) D315E probably damaging Het
Ampd3 T A 7: 110,394,998 (GRCm39) F316I probably damaging Het
Arhgef40 A C 14: 52,234,431 (GRCm39) E911D probably damaging Het
Atxn2l A G 7: 126,100,588 (GRCm39) probably null Het
Bckdhb T G 9: 83,835,789 (GRCm39) F98V probably damaging Het
Calhm1 C T 19: 47,132,280 (GRCm39) V112I probably benign Het
Ccdc28a G A 10: 18,100,699 (GRCm39) R90C probably damaging Het
Cdc40 A T 10: 40,724,048 (GRCm39) Y247N probably benign Het
Cds1 G A 5: 101,962,299 (GRCm39) V305M probably damaging Het
Cep128 T G 12: 90,966,309 (GRCm39) probably benign Het
Cep72 A T 13: 74,186,423 (GRCm39) H249Q probably damaging Het
Cfap70 A T 14: 20,498,631 (GRCm39) Y19N probably damaging Het
Col11a1 T C 3: 114,012,364 (GRCm39) probably benign Het
Cstdc6 T C 16: 36,143,386 (GRCm39) probably null Het
Cysltr1 A G X: 105,622,261 (GRCm39) V75A possibly damaging Het
Dnaaf11 T A 15: 66,252,323 (GRCm39) M448L probably benign Het
Dnah17 G T 11: 117,981,575 (GRCm39) Y1716* probably null Het
Dnm1 T C 2: 32,225,836 (GRCm39) E383G possibly damaging Het
Dst C A 1: 34,329,437 (GRCm39) probably null Het
Edil3 T C 13: 89,332,968 (GRCm39) S375P probably damaging Het
Eme1 A G 11: 94,540,908 (GRCm39) C277R probably damaging Het
Enam T C 5: 88,640,886 (GRCm39) W183R possibly damaging Het
Fbxl6 C T 15: 76,420,953 (GRCm39) V341M probably benign Het
Fgf14 A G 14: 124,914,015 (GRCm39) S39P probably damaging Het
Fmo4 C T 1: 162,631,220 (GRCm39) R249H possibly damaging Het
Gle1 T A 2: 29,830,240 (GRCm39) D265E probably benign Het
Golgb1 G T 16: 36,736,692 (GRCm39) E1980* probably null Het
Hap1 A G 11: 100,240,131 (GRCm39) L555P probably damaging Het
Heca T C 10: 17,791,039 (GRCm39) D339G possibly damaging Het
Hepacam2 T C 6: 3,483,479 (GRCm39) T101A possibly damaging Het
Ift88 T C 14: 57,733,678 (GRCm39) V707A probably benign Het
Kdm3a C T 6: 71,597,030 (GRCm39) G252D probably benign Het
Klhl11 A G 11: 100,363,068 (GRCm39) Y163H probably damaging Het
Kntc1 A T 5: 123,924,137 (GRCm39) N1008Y probably damaging Het
Lrp2 G T 2: 69,316,587 (GRCm39) N2131K probably benign Het
Magi3 C G 3: 103,924,873 (GRCm39) G1092A probably damaging Het
Mef2a G T 7: 66,884,896 (GRCm39) S406* probably null Het
Minar2 A G 18: 59,195,531 (GRCm39) probably null Het
Mrps26 G T 2: 130,405,778 (GRCm39) R27L possibly damaging Het
Myof T C 19: 37,904,952 (GRCm39) D1624G probably damaging Het
Naif1 T C 2: 32,344,908 (GRCm39) M204T probably benign Het
Ndufb8 T C 19: 44,538,784 (GRCm39) E179G possibly damaging Het
Neb A T 2: 52,216,769 (GRCm39) D135E probably benign Het
Nlrp6 C T 7: 140,503,399 (GRCm39) Q502* probably null Het
Nploc4 A G 11: 120,304,507 (GRCm39) L238P probably damaging Het
Obi1 T C 14: 104,716,963 (GRCm39) Y470C probably damaging Het
Or4d2 G A 11: 87,784,022 (GRCm39) H243Y probably damaging Het
Parp4 T A 14: 56,839,861 (GRCm39) V523E probably damaging Het
Pdgfra T C 5: 75,324,438 (GRCm39) Y98H probably damaging Het
Plcz1 C T 6: 139,936,459 (GRCm39) R590H probably damaging Het
Pnliprp1 T A 19: 58,726,628 (GRCm39) Y328* probably null Het
Pnpla8 C T 12: 44,330,246 (GRCm39) P48L probably benign Het
Rab44 T A 17: 29,366,317 (GRCm39) probably null Het
Ranbp2 T C 10: 58,329,720 (GRCm39) I3031T probably damaging Het
Sbno1 T C 5: 124,522,604 (GRCm39) D1072G probably damaging Het
Senp7 A G 16: 55,944,236 (GRCm39) T187A possibly damaging Het
Serpinh1 A G 7: 98,998,601 (GRCm39) C10R unknown Het
Sh2d4a A G 8: 68,799,346 (GRCm39) Y405C possibly damaging Het
Slc26a7 T C 4: 14,621,317 (GRCm39) D23G probably benign Het
Slc7a7 A G 14: 54,615,259 (GRCm39) L246P probably damaging Het
Spire1 T C 18: 67,661,945 (GRCm39) R163G probably damaging Het
Stxbp2 T A 8: 3,682,559 (GRCm39) D49E probably damaging Het
Susd2 C T 10: 75,474,069 (GRCm39) A509T probably benign Het
Sycp2 A G 2: 178,024,197 (GRCm39) F396L probably damaging Het
Syne2 T C 12: 76,010,587 (GRCm39) L2499P probably damaging Het
Syt10 C A 15: 89,711,144 (GRCm39) A130S probably benign Het
Sytl4 A T X: 132,862,936 (GRCm39) D16E probably benign Het
Tab2 C T 10: 7,795,883 (GRCm39) V126I probably damaging Het
Tecpr1 T C 5: 144,148,317 (GRCm39) T363A probably damaging Het
Terb2 A G 2: 122,016,816 (GRCm39) D16G probably benign Het
Tm2d2 A G 8: 25,510,552 (GRCm39) E137G probably benign Het
Trim30d T A 7: 104,121,692 (GRCm39) H201L probably damaging Het
Tspan3 A G 9: 56,054,669 (GRCm39) probably null Het
Ttn A T 2: 76,617,667 (GRCm39) L16268Q probably damaging Het
Ttn A T 2: 76,626,529 (GRCm39) probably null Het
Ubap2 T A 4: 41,218,319 (GRCm39) T263S probably benign Het
Vmn2r100 C A 17: 19,742,382 (GRCm39) P252Q possibly damaging Het
Zeb2 A T 2: 44,886,138 (GRCm39) M973K possibly damaging Het
Zfp229 A G 17: 21,965,615 (GRCm39) E615G probably damaging Het
Zfp655 T A 5: 145,180,867 (GRCm39) S242T possibly damaging Het
Zfp788 T A 7: 41,297,705 (GRCm39) F62I possibly damaging Het
Zmynd8 A G 2: 165,629,078 (GRCm39) probably null Het
Other mutations in Gml2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01649:Gml2 APN 15 74,696,070 (GRCm39) nonsense probably null
R0031:Gml2 UTSW 15 74,696,125 (GRCm39) missense probably benign 0.12
R1087:Gml2 UTSW 15 74,695,946 (GRCm39) missense possibly damaging 0.73
R1130:Gml2 UTSW 15 74,693,195 (GRCm39) missense probably damaging 0.99
R1503:Gml2 UTSW 15 74,693,201 (GRCm39) nonsense probably null
R4408:Gml2 UTSW 15 74,696,188 (GRCm39) intron probably benign
R6802:Gml2 UTSW 15 74,696,095 (GRCm39) missense probably damaging 1.00
R7351:Gml2 UTSW 15 74,693,225 (GRCm39) missense possibly damaging 0.57
R7833:Gml2 UTSW 15 74,693,217 (GRCm39) nonsense probably null
R7910:Gml2 UTSW 15 74,692,379 (GRCm39) critical splice acceptor site probably null
R8513:Gml2 UTSW 15 74,696,004 (GRCm39) missense probably damaging 1.00
R8695:Gml2 UTSW 15 74,696,089 (GRCm39) missense probably benign 0.05
R9377:Gml2 UTSW 15 74,695,957 (GRCm39) missense probably benign 0.02
X0066:Gml2 UTSW 15 74,695,899 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TAGGGGAGTCACCATTCCACAGAC -3'
(R):5'- GCCATTAGGCACACTACTCAAGCAG -3'

Sequencing Primer
(F):5'- GCCTTAGACTATGCCAGAATGTG -3'
(R):5'- TACTCAAGCAGTGGGCTGAAC -3'
Posted On 2013-07-11