Mutagenetix > Incidental Mutation

Incidental Mutation 'R0608:Fbxl6'

54445

Institutional Source

Beutler Lab

Gene Symbol

Fbxl6

Ensembl Gene

ENSMUSG00000022559

Gene Name

F-box and leucine-rich repeat protein 6

Synonyms

MMRRC Submission

038797-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.121) question?

Stock #

R0608 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

76535721-76538746 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 76536753 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 341 (V341M)

Ref Sequence

ENSEMBL: ENSMUSP00000023219 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023219] [ENSMUST00000023220] [ENSMUST00000230604]

AlphaFold

Q9QXW0

Predicted Effect

probably benign
Transcript: ENSMUST00000023219
AA Change: V341M

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000023219
Gene: ENSMUSG00000022559
AA Change: V341M

Domain	Start	End	E-Value	Type
low complexity region	2	22	N/A	INTRINSIC
low complexity region	58	77	N/A	INTRINSIC
Pfam:F-box	104	154	3.1e-6	PFAM
Pfam:F-box-like	105	155	1.8e-13	PFAM
low complexity region	163	174	N/A	INTRINSIC
SCOP:d1yrga_	184	448	3e-9	SMART
Blast:LRR	211	236	2e-6	BLAST
Blast:LRR	347	373	6e-8	BLAST
Blast:LRR	375	405	7e-9	BLAST
Blast:LRR	432	456	7e-6	BLAST
Blast:LRR	464	488	1e-5	BLAST
Blast:LRR	489	520	7e-13	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000023220

SMART Domains

Protein: ENSMUSP00000023220
Gene: ENSMUSG00000022560

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
low complexity region	32	43	N/A	INTRINSIC
transmembrane domain	46	68	N/A	INTRINSIC
transmembrane domain	81	103	N/A	INTRINSIC
transmembrane domain	113	135	N/A	INTRINSIC
transmembrane domain	142	164	N/A	INTRINSIC
transmembrane domain	201	223	N/A	INTRINSIC
Pfam:DUF1011	278	376	3e-38	PFAM
transmembrane domain	409	431	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228994

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229074

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229273

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229813

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230513

Predicted Effect

probably benign
Transcript: ENSMUST00000230604

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230938

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230994

Coding Region Coverage

1x: 99.4%
3x: 99.0%
10x: 97.7%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that are characterized by an F-box motif. The encoded protein also contains leucine-rich repeats. F-box-containing proteins comprise one of the subunits of the SCF (SKP1-cullin-F-box) complex, which functions in phosphorylation-dependent ubiquitination. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A730017C20Rik	A	G	18: 59,062,459		probably null	Het
Akap11	A	G	14: 78,510,753	V1398A	probably benign	Het
Ampd3	C	A	7: 110,795,790	D315E	probably damaging	Het
Ampd3	T	A	7: 110,795,791	F316I	probably damaging	Het
Arhgef40	A	C	14: 51,996,974	E911D	probably damaging	Het
Atxn2l	A	G	7: 126,501,416		probably null	Het
BC117090	T	C	16: 36,323,024		probably null	Het
Bckdhb	T	G	9: 83,953,736	F98V	probably damaging	Het
Calhm1	C	T	19: 47,143,841	V112I	probably benign	Het
Ccdc28a	G	A	10: 18,224,951	R90C	probably damaging	Het
Cdc40	A	T	10: 40,848,052	Y247N	probably benign	Het
Cds1	G	A	5: 101,814,433	V305M	probably damaging	Het
Cep128	T	G	12: 90,999,535		probably benign	Het
Cep72	A	T	13: 74,038,304	H249Q	probably damaging	Het
Cfap70	A	T	14: 20,448,563	Y19N	probably damaging	Het
Col11a1	T	C	3: 114,218,715		probably benign	Het
Cysltr1	A	G	X: 106,578,655	V75A	possibly damaging	Het
Dnah17	G	T	11: 118,090,749	Y1716*	probably null	Het
Dnm1	T	C	2: 32,335,824	E383G	possibly damaging	Het
Dst	C	A	1: 34,290,356		probably null	Het
Edil3	T	C	13: 89,184,849	S375P	probably damaging	Het
Eme1	A	G	11: 94,650,082	C277R	probably damaging	Het
Enam	T	C	5: 88,493,027	W183R	possibly damaging	Het
Fgf14	A	G	14: 124,676,603	S39P	probably damaging	Het
Fmo4	C	T	1: 162,803,651	R249H	possibly damaging	Het
Gle1	T	A	2: 29,940,228	D265E	probably benign	Het
Gml2	T	C	15: 74,821,386		probably null	Het
Golgb1	G	T	16: 36,916,330	E1980*	probably null	Het
Hap1	A	G	11: 100,349,305	L555P	probably damaging	Het
Heca	T	C	10: 17,915,291	D339G	possibly damaging	Het
Hepacam2	T	C	6: 3,483,479	T101A	possibly damaging	Het
Ift88	T	C	14: 57,496,221	V707A	probably benign	Het
Kdm3a	C	T	6: 71,620,046	G252D	probably benign	Het
Klhl11	A	G	11: 100,472,242	Y163H	probably damaging	Het
Kntc1	A	T	5: 123,786,074	N1008Y	probably damaging	Het
Lrp2	G	T	2: 69,486,243	N2131K	probably benign	Het
Lrrc6	T	A	15: 66,380,474	M448L	probably benign	Het
Magi3	C	G	3: 104,017,557	G1092A	probably damaging	Het
Mef2a	G	T	7: 67,235,148	S406*	probably null	Het
Mrps26	G	T	2: 130,563,858	R27L	possibly damaging	Het
Myof	T	C	19: 37,916,504	D1624G	probably damaging	Het
Naif1	T	C	2: 32,454,896	M204T	probably benign	Het
Ndufb8	T	C	19: 44,550,345	E179G	possibly damaging	Het
Neb	A	T	2: 52,326,757	D135E	probably benign	Het
Nlrp6	C	T	7: 140,923,486	Q502*	probably null	Het
Nploc4	A	G	11: 120,413,681	L238P	probably damaging	Het
Olfr463	G	A	11: 87,893,196	H243Y	probably damaging	Het
Parp4	T	A	14: 56,602,404	V523E	probably damaging	Het
Pdgfra	T	C	5: 75,163,777	Y98H	probably damaging	Het
Plcz1	C	T	6: 139,990,733	R590H	probably damaging	Het
Pnliprp1	T	A	19: 58,738,196	Y328*	probably null	Het
Pnpla8	C	T	12: 44,283,463	P48L	probably benign	Het
Rab44	T	A	17: 29,147,343		probably null	Het
Ranbp2	T	C	10: 58,493,898	I3031T	probably damaging	Het
Rnf219	T	C	14: 104,479,527	Y470C	probably damaging	Het
Sbno1	T	C	5: 124,384,541	D1072G	probably damaging	Het
Senp7	A	G	16: 56,123,873	T187A	possibly damaging	Het
Serpinh1	A	G	7: 99,349,394	C10R	unknown	Het
Sh2d4a	A	G	8: 68,346,694	Y405C	possibly damaging	Het
Slc26a7	T	C	4: 14,621,317	D23G	probably benign	Het
Slc7a7	A	G	14: 54,377,802	L246P	probably damaging	Het
Spire1	T	C	18: 67,528,875	R163G	probably damaging	Het
Stxbp2	T	A	8: 3,632,559	D49E	probably damaging	Het
Susd2	C	T	10: 75,638,235	A509T	probably benign	Het
Sycp2	A	G	2: 178,382,404	F396L	probably damaging	Het
Syne2	T	C	12: 75,963,813	L2499P	probably damaging	Het
Syt10	C	A	15: 89,826,941	A130S	probably benign	Het
Sytl4	A	T	X: 133,962,187	D16E	probably benign	Het
Tab2	C	T	10: 7,920,119	V126I	probably damaging	Het
Tecpr1	T	C	5: 144,211,499	T363A	probably damaging	Het
Terb2	A	G	2: 122,186,335	D16G	probably benign	Het
Tm2d2	A	G	8: 25,020,536	E137G	probably benign	Het
Trim30d	T	A	7: 104,472,485	H201L	probably damaging	Het
Tspan3	A	G	9: 56,147,385		probably null	Het
Ttn	A	T	2: 76,787,323	L16268Q	probably damaging	Het
Ttn	A	T	2: 76,796,185		probably null	Het
Ubap2	T	A	4: 41,218,319	T263S	probably benign	Het
Vmn2r100	C	A	17: 19,522,120	P252Q	possibly damaging	Het
Zeb2	A	T	2: 44,996,126	M973K	possibly damaging	Het
Zfp229	A	G	17: 21,746,634	E615G	probably damaging	Het
Zfp655	T	A	5: 145,244,057	S242T	possibly damaging	Het
Zfp788	T	A	7: 41,648,281	F62I	possibly damaging	Het
Zmynd8	A	G	2: 165,787,158		probably null	Het

Other mutations in Fbxl6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02088:Fbxl6	APN	15	76535906	nonsense	probably null
IGL02205:Fbxl6	APN	15	76537341	missense	probably benign	0.05
R0244:Fbxl6	UTSW	15	76537191	missense	probably damaging	1.00
R0449:Fbxl6	UTSW	15	76535955	missense	probably damaging	1.00
R0904:Fbxl6	UTSW	15	76537083	splice site	probably null
R1477:Fbxl6	UTSW	15	76537734	missense	probably benign
R1784:Fbxl6	UTSW	15	76538058	missense	probably damaging	1.00
R2109:Fbxl6	UTSW	15	76536973	missense	probably damaging	0.99
R3937:Fbxl6	UTSW	15	76536624	nonsense	probably null
R4414:Fbxl6	UTSW	15	76537724	missense	possibly damaging	0.76
R4416:Fbxl6	UTSW	15	76537724	missense	possibly damaging	0.76
R4483:Fbxl6	UTSW	15	76537929	missense	probably damaging	1.00
R4835:Fbxl6	UTSW	15	76536804	missense	probably damaging	1.00
R6175:Fbxl6	UTSW	15	76538433	missense	probably benign
R6345:Fbxl6	UTSW	15	76535854	missense	probably damaging	1.00
R6750:Fbxl6	UTSW	15	76538412	missense	probably damaging	1.00
R6800:Fbxl6	UTSW	15	76538698	unclassified	probably benign
R7485:Fbxl6	UTSW	15	76537913	splice site	probably null
R7560:Fbxl6	UTSW	15	76538469	missense	probably benign	0.06
R7726:Fbxl6	UTSW	15	76535886	missense	probably damaging	1.00
R7811:Fbxl6	UTSW	15	76537285	splice site	probably null
R8353:Fbxl6	UTSW	15	76538478	missense	probably benign	0.06
R8548:Fbxl6	UTSW	15	76537342	missense	possibly damaging	0.65
X0058:Fbxl6	UTSW	15	76538476	missense	possibly damaging	0.71

Predicted Primers

PCR Primer
(F):5'- CCTTGACATGGCAGATGACACAGAC -3'
(R):5'- CAGCACTGGCATGAACTGCAAC -3'

Sequencing Primer
(F):5'- CACAGACCGCTAGGAGTGAC -3'
(R):5'- AGCTGCCTGTGGAAGCC -3'

Posted On

2013-07-11