Incidental Mutation 'R7000:Casz1'
ID544457
Institutional Source Beutler Lab
Gene Symbol Casz1
Ensembl Gene ENSMUSG00000028977
Gene Namecastor zinc finger 1
SynonymsD4Ertd432e, 2410019P08Rik, Cst, castor
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7000 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location148804429-148954889 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 148929236 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 86 (A86T)
Ref Sequence ENSEMBL: ENSMUSP00000092035 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094464] [ENSMUST00000122222] [ENSMUST00000139806] [ENSMUST00000147270]
Predicted Effect probably damaging
Transcript: ENSMUST00000094464
AA Change: A86T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092035
Gene: ENSMUSG00000028977
AA Change: A86T

DomainStartEndE-ValueType
low complexity region 403 420 N/A INTRINSIC
ZnF_C2H2 489 514 5.34e0 SMART
ZnF_C2H2 550 574 8.09e-1 SMART
ZnF_C2H2 609 633 9.3e-1 SMART
low complexity region 643 658 N/A INTRINSIC
ZnF_C2H2 667 691 1.1e-2 SMART
low complexity region 698 711 N/A INTRINSIC
low complexity region 728 766 N/A INTRINSIC
low complexity region 796 807 N/A INTRINSIC
low complexity region 810 834 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 951 957 N/A INTRINSIC
ZnF_C2H2 1031 1055 2.29e1 SMART
low complexity region 1080 1091 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000122222
AA Change: A86T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112978
Gene: ENSMUSG00000028977
AA Change: A86T

DomainStartEndE-ValueType
low complexity region 403 420 N/A INTRINSIC
ZnF_C2H2 489 514 5.34e0 SMART
ZnF_C2H2 550 574 8.09e-1 SMART
ZnF_C2H2 609 633 9.3e-1 SMART
low complexity region 643 658 N/A INTRINSIC
ZnF_C2H2 667 691 1.1e-2 SMART
low complexity region 698 711 N/A INTRINSIC
low complexity region 728 766 N/A INTRINSIC
low complexity region 796 807 N/A INTRINSIC
low complexity region 810 834 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 951 957 N/A INTRINSIC
ZnF_C2H2 1031 1055 2.29e1 SMART
low complexity region 1080 1091 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
ZnF_C2H2 1182 1206 1.59e1 SMART
ZnF_C2H2 1242 1266 2.47e1 SMART
ZnF_C2H2 1300 1324 3.47e0 SMART
ZnF_C2H2 1457 1481 7.89e0 SMART
ZnF_C2H2 1515 1537 3.21e1 SMART
ZnF_C2H2 1571 1595 3.99e0 SMART
low complexity region 1632 1649 N/A INTRINSIC
SCOP:d1qbkb_ 1675 1742 2e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139806
SMART Domains Protein: ENSMUSP00000120307
Gene: ENSMUSG00000028977

DomainStartEndE-ValueType
low complexity region 117 134 N/A INTRINSIC
ZnF_C2H2 203 228 5.34e0 SMART
ZnF_C2H2 264 288 8.09e-1 SMART
ZnF_C2H2 323 347 9.3e-1 SMART
low complexity region 357 372 N/A INTRINSIC
ZnF_C2H2 381 405 1.1e-2 SMART
low complexity region 412 425 N/A INTRINSIC
low complexity region 442 480 N/A INTRINSIC
low complexity region 510 521 N/A INTRINSIC
low complexity region 524 548 N/A INTRINSIC
low complexity region 589 604 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000147270
AA Change: A86T

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcription factor. The encoded protein may function as a tumor suppressor, and single nucleotide polymorphisms in this gene are associated with blood pressure variation. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete lethality throughout fetal growth and development and abnormal heart development associated with edema, decreased fetal cardiomyocyte proliferation, myocardium hypoplasia, ventricular septal defect, and altered heart shape and Z line formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a G A 5: 8,702,823 A525T probably benign Het
Abcc6 A G 7: 46,005,522 I515T possibly damaging Het
Abi1 G A 2: 22,942,041 A420V probably damaging Het
Abtb2 A T 2: 103,712,442 I887F possibly damaging Het
Acap3 G A 4: 155,903,849 G602S possibly damaging Het
Auts2 T A 5: 131,440,218 T754S probably benign Het
AW551984 T C 9: 39,600,789 R12G probably benign Het
AW822073 T C 10: 58,222,992 T647A possibly damaging Het
Bcan G A 3: 87,988,379 R817* probably null Het
Bmp10 A G 6: 87,434,193 T323A probably benign Het
Bpnt1 T C 1: 185,349,856 L165P probably damaging Het
Cd1d2 T C 3: 86,987,773 F189L probably benign Het
Cep72 A G 13: 74,058,325 M126T probably damaging Het
Cep85l T A 10: 53,298,199 T483S probably damaging Het
Cfi C A 3: 129,872,873 T415K probably damaging Het
Chrna7 A G 7: 63,106,039 L253S probably damaging Het
Col4a4 T C 1: 82,497,330 H596R unknown Het
Cyp2j8 A T 4: 96,447,351 M402K probably benign Het
Cyp3a16 T A 5: 145,463,170 probably null Het
Dhdh T C 7: 45,475,274 K332E possibly damaging Het
Dnah11 C A 12: 118,017,661 C2590F probably damaging Het
Dnah17 T C 11: 118,025,702 probably null Het
Dtx1 A G 5: 120,695,083 Y97H probably damaging Het
Elf1 A G 14: 79,570,768 D183G probably damaging Het
Esyt3 A C 9: 99,322,153 L94R probably damaging Het
Exoc3 A G 13: 74,182,166 Y521H probably benign Het
F5 C T 1: 164,179,506 T293M probably damaging Het
Fam118b A T 9: 35,235,264 H102Q probably damaging Het
Flad1 T C 3: 89,402,242 probably benign Het
Flrt3 G A 2: 140,660,884 R275* probably null Het
Fndc7 G A 3: 108,876,648 A215V probably benign Het
Fscn1 T A 5: 142,960,627 V60E probably damaging Het
Gm17175 A T 14: 51,573,961 M1K probably null Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Gprc6a T C 10: 51,615,047 S694G probably benign Het
Iglon5 A T 7: 43,476,830 probably null Het
Iqch T C 9: 63,454,610 T874A probably benign Het
Lamc2 T A 1: 153,166,127 H87L possibly damaging Het
Ldlrad1 T A 4: 107,209,580 D37E probably benign Het
Lman1l G C 9: 57,615,948 Q109E probably benign Het
Loxhd1 T C 18: 77,372,433 probably null Het
Lxn T G 3: 67,462,371 E60D probably benign Het
Man2b2 A G 5: 36,821,869 W276R probably damaging Het
Mast1 T C 8: 84,928,969 Y182C probably damaging Het
Mroh8 C T 2: 157,216,977 R923Q probably benign Het
Nov A T 15: 54,752,347 T303S probably damaging Het
Obscn A G 11: 59,136,038 L113P probably damaging Het
Ocln C T 13: 100,534,962 probably null Het
Olfr1467 A G 19: 13,364,623 probably benign Het
Olfr671 G A 7: 104,975,131 P285S probably damaging Het
Oog2 A T 4: 144,195,327 Q269L probably damaging Het
Osbpl3 A G 6: 50,297,157 S826P probably damaging Het
Otogl T C 10: 107,779,831 N1869S probably benign Het
Pamr1 G A 2: 102,611,623 D186N probably damaging Het
Pcdhga8 T A 18: 37,726,893 I334K probably benign Het
Pde7b A G 10: 20,443,292 S95P probably damaging Het
Pik3cg A T 12: 32,192,129 V994E probably damaging Het
Pkp1 T C 1: 135,889,954 M148V probably benign Het
Plbd1 T G 6: 136,612,838 K461Q probably benign Het
Pmfbp1 A G 8: 109,530,589 E594G possibly damaging Het
Pold3 A T 7: 100,106,658 H60Q probably damaging Het
Polr3gl C T 3: 96,580,467 R52Q possibly damaging Het
Ptgds A G 2: 25,467,816 probably null Het
Scarb2 T C 5: 92,454,075 D320G probably benign Het
Sdk2 T C 11: 113,803,169 Y1812C probably damaging Het
Skint8 C A 4: 111,937,025 T204N probably benign Het
Slc23a2 T C 2: 132,094,203 Q49R possibly damaging Het
Slc26a7 T C 4: 14,552,476 Q227R probably benign Het
Sntn C T 14: 13,679,108 T94I probably damaging Het
Spem2 C T 11: 69,817,756 G128S probably benign Het
Supt16 A T 14: 52,171,450 S822R probably damaging Het
Syn3 T C 10: 86,080,252 Y290C probably damaging Het
Tdrd6 C G 17: 43,627,708 E816D probably benign Het
Tln1 A T 4: 43,556,302 M72K probably damaging Het
Tlnrd1 A G 7: 83,882,779 V148A probably damaging Het
Trim24 C A 6: 37,958,678 T832K probably benign Het
Ubr4 C T 4: 139,414,404 A1267V probably damaging Het
Usp17lb A T 7: 104,841,285 M145K probably damaging Het
Vmn1r178 T A 7: 23,894,337 M270K probably benign Het
Vmn2r70 A T 7: 85,559,611 C553S probably damaging Het
Vps37c G T 19: 10,710,329 E51D probably damaging Het
Zfp62 T G 11: 49,216,379 Y432* probably null Het
Other mutations in Casz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00914:Casz1 APN 4 148929371 missense probably damaging 1.00
IGL02137:Casz1 APN 4 148933468 missense possibly damaging 0.71
IGL02176:Casz1 APN 4 148934619 missense probably damaging 1.00
IGL02629:Casz1 APN 4 148944391 missense probably benign 0.01
IGL02871:Casz1 APN 4 148944319 missense possibly damaging 0.93
FR4340:Casz1 UTSW 4 148952302 small deletion probably benign
H8562:Casz1 UTSW 4 148933451 missense probably damaging 1.00
R0090:Casz1 UTSW 4 148933411 missense probably benign 0.00
R0389:Casz1 UTSW 4 148948911 missense possibly damaging 0.83
R0443:Casz1 UTSW 4 148948911 missense possibly damaging 0.83
R0550:Casz1 UTSW 4 148952284 small deletion probably benign
R0597:Casz1 UTSW 4 148944394 missense probably benign 0.00
R1117:Casz1 UTSW 4 148934595 missense probably damaging 1.00
R1476:Casz1 UTSW 4 148946171 missense probably benign 0.05
R1540:Casz1 UTSW 4 148942900 unclassified probably benign
R1610:Casz1 UTSW 4 148929087 missense possibly damaging 0.54
R1764:Casz1 UTSW 4 148942900 unclassified probably benign
R1779:Casz1 UTSW 4 148932937 missense probably benign 0.00
R1874:Casz1 UTSW 4 148943211 missense probably damaging 0.99
R1902:Casz1 UTSW 4 148936195 missense possibly damaging 0.95
R1914:Casz1 UTSW 4 148932958 missense probably damaging 1.00
R2126:Casz1 UTSW 4 148946064 missense probably damaging 0.99
R2261:Casz1 UTSW 4 148929099 missense probably damaging 0.96
R2262:Casz1 UTSW 4 148929099 missense probably damaging 0.96
R3874:Casz1 UTSW 4 148939589 intron probably benign
R4019:Casz1 UTSW 4 148932878 missense probably benign 0.00
R4355:Casz1 UTSW 4 148952335 missense unknown
R4420:Casz1 UTSW 4 148948918 missense possibly damaging 0.90
R4610:Casz1 UTSW 4 148933267 missense probably damaging 1.00
R4632:Casz1 UTSW 4 148951855 missense possibly damaging 0.71
R4762:Casz1 UTSW 4 148938981 missense probably damaging 1.00
R4824:Casz1 UTSW 4 148944571 missense probably damaging 1.00
R4907:Casz1 UTSW 4 148944541 missense probably damaging 1.00
R5628:Casz1 UTSW 4 148946096 missense probably damaging 1.00
R5736:Casz1 UTSW 4 148929410 missense probably benign 0.00
R5929:Casz1 UTSW 4 148938696 missense probably damaging 1.00
R5929:Casz1 UTSW 4 148938969 missense probably damaging 1.00
R5932:Casz1 UTSW 4 148939113 missense possibly damaging 0.52
R6016:Casz1 UTSW 4 148934584 missense probably damaging 1.00
R6019:Casz1 UTSW 4 148947038 missense probably damaging 0.99
R6139:Casz1 UTSW 4 148951697 missense probably damaging 1.00
R6223:Casz1 UTSW 4 148933383 missense probably damaging 1.00
R6239:Casz1 UTSW 4 148938277 missense probably damaging 1.00
R6323:Casz1 UTSW 4 148941704 missense possibly damaging 0.89
R6354:Casz1 UTSW 4 148952542 missense unknown
R6454:Casz1 UTSW 4 148951495 missense probably damaging 0.99
R6479:Casz1 UTSW 4 148937078 missense probably damaging 1.00
R6529:Casz1 UTSW 4 148938189 missense probably damaging 1.00
R6772:Casz1 UTSW 4 148943206 missense probably damaging 1.00
R7152:Casz1 UTSW 4 148901291 start gained probably benign
R7324:Casz1 UTSW 4 148947033 missense probably damaging 0.99
R7339:Casz1 UTSW 4 148951745 missense probably damaging 1.00
R7388:Casz1 UTSW 4 148952393 missense unknown
R7480:Casz1 UTSW 4 148944586 missense probably damaging 0.99
R7719:Casz1 UTSW 4 148944524 missense probably damaging 0.99
R7789:Casz1 UTSW 4 148929406 missense probably benign
R7801:Casz1 UTSW 4 148938249 missense probably damaging 0.99
R7815:Casz1 UTSW 4 148929305 missense possibly damaging 0.89
R7818:Casz1 UTSW 4 148946076 missense probably damaging 1.00
RF001:Casz1 UTSW 4 148952304 small deletion probably benign
RF063:Casz1 UTSW 4 148952304 small deletion probably benign
X0018:Casz1 UTSW 4 148939008 missense probably damaging 1.00
X0064:Casz1 UTSW 4 148932952 missense probably damaging 0.99
Z1088:Casz1 UTSW 4 148944359 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCATCCTTGCAGCTGAAAGC -3'
(R):5'- GACACTGTTATCTTTTGAGGGC -3'

Sequencing Primer
(F):5'- TGCAGGCAAGCCTCCAATG -3'
(R):5'- AGGGCTCTTCTGCATGGTC -3'
Posted On2019-05-13