Incidental Mutation 'R7000:Auts2'
ID544463
Institutional Source Beutler Lab
Gene Symbol Auts2
Ensembl Gene ENSMUSG00000029673
Gene Nameautism susceptibility candidate 2
SynonymsD830032G16Rik, 2700063G02Rik, A730011F23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7000 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location131437333-132543344 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 131440218 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 754 (T754S)
Ref Sequence ENSEMBL: ENSMUSP00000139759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161374] [ENSMUST00000161804] [ENSMUST00000187544]
Predicted Effect probably benign
Transcript: ENSMUST00000161374
AA Change: T530S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124730
Gene: ENSMUSG00000029673
AA Change: T530S

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 67 84 N/A INTRINSIC
low complexity region 92 105 N/A INTRINSIC
Pfam:Auts2 172 384 1.5e-112 PFAM
low complexity region 411 424 N/A INTRINSIC
low complexity region 533 543 N/A INTRINSIC
low complexity region 599 614 N/A INTRINSIC
low complexity region 741 757 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000124027
Gene: ENSMUSG00000029673
AA Change: T545S

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 67 84 N/A INTRINSIC
low complexity region 92 105 N/A INTRINSIC
Pfam:Auts2 187 399 3.9e-113 PFAM
low complexity region 426 439 N/A INTRINSIC
low complexity region 548 558 N/A INTRINSIC
low complexity region 614 629 N/A INTRINSIC
low complexity region 756 772 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162101
Predicted Effect probably benign
Transcript: ENSMUST00000187544
AA Change: T754S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000139759
Gene: ENSMUSG00000029673
AA Change: T754S

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
low complexity region 83 125 N/A INTRINSIC
low complexity region 127 161 N/A INTRINSIC
low complexity region 168 183 N/A INTRINSIC
low complexity region 212 224 N/A INTRINSIC
low complexity region 276 293 N/A INTRINSIC
low complexity region 301 314 N/A INTRINSIC
Pfam:Auts2 396 608 4.3e-109 PFAM
low complexity region 635 648 N/A INTRINSIC
low complexity region 757 767 N/A INTRINSIC
low complexity region 823 838 N/A INTRINSIC
low complexity region 965 981 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene has been implicated in neurodevelopment and as a candidate gene for numerous neurological disorders, including autism spectrum disorders, intellectual disability, and developmental delay. Mutations in this gene have also been associated with non-neurological disorders, such as acute lymphoblastic leukemia, aging of the skin, early-onset androgenetic alopecia, and certain cancers. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a brain-specific knockout are smaller than controls, and exhibit behavioral defects such as less vocalizations, impairments in righting response and geotaxis, and decreased food intake. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a G A 5: 8,702,823 A525T probably benign Het
Abcc6 A G 7: 46,005,522 I515T possibly damaging Het
Abi1 G A 2: 22,942,041 A420V probably damaging Het
Abtb2 A T 2: 103,712,442 I887F possibly damaging Het
Acap3 G A 4: 155,903,849 G602S possibly damaging Het
AW551984 T C 9: 39,600,789 R12G probably benign Het
AW822073 T C 10: 58,222,992 T647A possibly damaging Het
Bcan G A 3: 87,988,379 R817* probably null Het
Bmp10 A G 6: 87,434,193 T323A probably benign Het
Bpnt1 T C 1: 185,349,856 L165P probably damaging Het
Casz1 G A 4: 148,929,236 A86T probably damaging Het
Cd1d2 T C 3: 86,987,773 F189L probably benign Het
Cep72 A G 13: 74,058,325 M126T probably damaging Het
Cep85l T A 10: 53,298,199 T483S probably damaging Het
Cfi C A 3: 129,872,873 T415K probably damaging Het
Chrna7 A G 7: 63,106,039 L253S probably damaging Het
Col4a4 T C 1: 82,497,330 H596R unknown Het
Cyp2j8 A T 4: 96,447,351 M402K probably benign Het
Cyp3a16 T A 5: 145,463,170 probably null Het
Dhdh T C 7: 45,475,274 K332E possibly damaging Het
Dnah11 C A 12: 118,017,661 C2590F probably damaging Het
Dnah17 T C 11: 118,025,702 probably null Het
Dtx1 A G 5: 120,695,083 Y97H probably damaging Het
Elf1 A G 14: 79,570,768 D183G probably damaging Het
Esyt3 A C 9: 99,322,153 L94R probably damaging Het
Exoc3 A G 13: 74,182,166 Y521H probably benign Het
F5 C T 1: 164,179,506 T293M probably damaging Het
Fam118b A T 9: 35,235,264 H102Q probably damaging Het
Flad1 T C 3: 89,402,242 probably benign Het
Flrt3 G A 2: 140,660,884 R275* probably null Het
Fndc7 G A 3: 108,876,648 A215V probably benign Het
Fscn1 T A 5: 142,960,627 V60E probably damaging Het
Gm17175 A T 14: 51,573,961 M1K probably null Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Gprc6a T C 10: 51,615,047 S694G probably benign Het
Iglon5 A T 7: 43,476,830 probably null Het
Iqch T C 9: 63,454,610 T874A probably benign Het
Lamc2 T A 1: 153,166,127 H87L possibly damaging Het
Ldlrad1 T A 4: 107,209,580 D37E probably benign Het
Lman1l G C 9: 57,615,948 Q109E probably benign Het
Loxhd1 T C 18: 77,372,433 probably null Het
Lxn T G 3: 67,462,371 E60D probably benign Het
Man2b2 A G 5: 36,821,869 W276R probably damaging Het
Mast1 T C 8: 84,928,969 Y182C probably damaging Het
Mroh8 C T 2: 157,216,977 R923Q probably benign Het
Nov A T 15: 54,752,347 T303S probably damaging Het
Obscn A G 11: 59,136,038 L113P probably damaging Het
Ocln C T 13: 100,534,962 probably null Het
Olfr1467 A G 19: 13,364,623 probably benign Het
Olfr671 G A 7: 104,975,131 P285S probably damaging Het
Oog2 A T 4: 144,195,327 Q269L probably damaging Het
Osbpl3 A G 6: 50,297,157 S826P probably damaging Het
Otogl T C 10: 107,779,831 N1869S probably benign Het
Pamr1 G A 2: 102,611,623 D186N probably damaging Het
Pcdhga8 T A 18: 37,726,893 I334K probably benign Het
Pde7b A G 10: 20,443,292 S95P probably damaging Het
Pik3cg A T 12: 32,192,129 V994E probably damaging Het
Pkp1 T C 1: 135,889,954 M148V probably benign Het
Plbd1 T G 6: 136,612,838 K461Q probably benign Het
Pmfbp1 A G 8: 109,530,589 E594G possibly damaging Het
Pold3 A T 7: 100,106,658 H60Q probably damaging Het
Polr3gl C T 3: 96,580,467 R52Q possibly damaging Het
Ptgds A G 2: 25,467,816 probably null Het
Scarb2 T C 5: 92,454,075 D320G probably benign Het
Sdk2 T C 11: 113,803,169 Y1812C probably damaging Het
Skint8 C A 4: 111,937,025 T204N probably benign Het
Slc23a2 T C 2: 132,094,203 Q49R possibly damaging Het
Slc26a7 T C 4: 14,552,476 Q227R probably benign Het
Sntn C T 14: 13,679,108 T94I probably damaging Het
Spem2 C T 11: 69,817,756 G128S probably benign Het
Supt16 A T 14: 52,171,450 S822R probably damaging Het
Syn3 T C 10: 86,080,252 Y290C probably damaging Het
Tdrd6 C G 17: 43,627,708 E816D probably benign Het
Tln1 A T 4: 43,556,302 M72K probably damaging Het
Tlnrd1 A G 7: 83,882,779 V148A probably damaging Het
Trim24 C A 6: 37,958,678 T832K probably benign Het
Ubr4 C T 4: 139,414,404 A1267V probably damaging Het
Usp17lb A T 7: 104,841,285 M145K probably damaging Het
Vmn1r178 T A 7: 23,894,337 M270K probably benign Het
Vmn2r70 A T 7: 85,559,611 C553S probably damaging Het
Vps37c G T 19: 10,710,329 E51D probably damaging Het
Zfp62 T G 11: 49,216,379 Y432* probably null Het
Other mutations in Auts2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01739:Auts2 APN 5 131440218 missense probably benign 0.00
IGL01751:Auts2 APN 5 131472360 missense probably damaging 0.99
IGL02070:Auts2 APN 5 131470421 missense probably damaging 1.00
R0032:Auts2 UTSW 5 131440093 missense probably damaging 1.00
R0033:Auts2 UTSW 5 131440093 missense probably damaging 1.00
R0046:Auts2 UTSW 5 131770785 exon noncoding transcript
R0399:Auts2 UTSW 5 131440524 missense probably benign 0.37
R0412:Auts2 UTSW 5 131446831 missense probably benign 0.02
R0551:Auts2 UTSW 5 131440469 missense possibly damaging 0.75
R1536:Auts2 UTSW 5 131487463 intron probably benign
R1573:Auts2 UTSW 5 131440487 missense probably damaging 1.00
R1789:Auts2 UTSW 5 131472450 missense probably damaging 1.00
R1912:Auts2 UTSW 5 131443574 missense probably damaging 1.00
R2431:Auts2 UTSW 5 132259048 nonsense probably null
R3745:Auts2 UTSW 5 131476587 utr 5 prime probably benign
R4290:Auts2 UTSW 5 131474971 missense probably damaging 1.00
R4575:Auts2 UTSW 5 132258934 missense probably benign 0.17
R4576:Auts2 UTSW 5 132258934 missense probably benign 0.17
R4578:Auts2 UTSW 5 132258934 missense probably benign 0.17
R4623:Auts2 UTSW 5 131440383 missense probably benign 0.25
R4632:Auts2 UTSW 5 131472275 missense probably damaging 1.00
R4663:Auts2 UTSW 5 131439638 missense probably damaging 1.00
R4835:Auts2 UTSW 5 131466093 missense probably damaging 1.00
R4881:Auts2 UTSW 5 131472450 missense probably damaging 1.00
R5030:Auts2 UTSW 5 131443498 missense probably benign 0.00
R5032:Auts2 UTSW 5 131476891 utr 5 prime probably benign
R5078:Auts2 UTSW 5 132258947 missense possibly damaging 0.85
R5093:Auts2 UTSW 5 131439458 missense probably damaging 0.99
R5182:Auts2 UTSW 5 131475081 missense probably null 0.01
R5305:Auts2 UTSW 5 131443794 intron probably benign
R5429:Auts2 UTSW 5 131472335 missense probably damaging 1.00
R5601:Auts2 UTSW 5 131476823 utr 5 prime probably benign
R5725:Auts2 UTSW 5 131439746 missense probably benign 0.35
R5990:Auts2 UTSW 5 131476895 utr 5 prime probably benign
R6074:Auts2 UTSW 5 131476989 utr 5 prime probably benign
R6130:Auts2 UTSW 5 131440223 missense probably damaging 1.00
R6321:Auts2 UTSW 5 131466115 missense probably damaging 1.00
R6974:Auts2 UTSW 5 131440599 missense probably benign 0.01
R7014:Auts2 UTSW 5 131466123 missense probably damaging 1.00
R7154:Auts2 UTSW 5 131451893 missense
R7812:Auts2 UTSW 5 131472446 missense
R7922:Auts2 UTSW 5 131440373 missense
R8159:Auts2 UTSW 5 131460125 critical splice donor site probably null
R8553:Auts2 UTSW 5 131440143 missense probably benign 0.00
Z1088:Auts2 UTSW 5 131476554 splice site probably benign
Predicted Primers PCR Primer
(F):5'- TATGGGAAACGCTCTCCTCCTG -3'
(R):5'- AGCCAAGGAAAGCCATCTGC -3'

Sequencing Primer
(F):5'- GAAACGCTCTCCTCCTGGGATC -3'
(R):5'- CATCTGCCCGAGAGAGATG -3'
Posted On2019-05-13