Incidental Mutation 'R7000:Olfr671'
ID544479
Institutional Source Beutler Lab
Gene Symbol Olfr671
Ensembl Gene ENSMUSG00000094531
Gene Nameolfactory receptor 671
SynonymsGA_x6K02T2PBJ9-7604826-7603885, MOR32-12
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R7000 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location104972896-104979126 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 104975131 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 285 (P285S)
Ref Sequence ENSEMBL: ENSMUSP00000077774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078710] [ENSMUST00000210963] [ENSMUST00000217091]
Predicted Effect probably damaging
Transcript: ENSMUST00000078710
AA Change: P285S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000077774
Gene: ENSMUSG00000094531
AA Change: P285S

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 1.4e-117 PFAM
Pfam:7TM_GPCR_Srsx 37 308 3.7e-7 PFAM
Pfam:7tm_1 43 293 1.5e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000210963
AA Change: P289S

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217091
AA Change: P289S

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a G A 5: 8,702,823 A525T probably benign Het
Abcc6 A G 7: 46,005,522 I515T possibly damaging Het
Abi1 G A 2: 22,942,041 A420V probably damaging Het
Abtb2 A T 2: 103,712,442 I887F possibly damaging Het
Acap3 G A 4: 155,903,849 G602S possibly damaging Het
Auts2 T A 5: 131,440,218 T754S probably benign Het
AW551984 T C 9: 39,600,789 R12G probably benign Het
AW822073 T C 10: 58,222,992 T647A possibly damaging Het
Bcan G A 3: 87,988,379 R817* probably null Het
Bmp10 A G 6: 87,434,193 T323A probably benign Het
Bpnt1 T C 1: 185,349,856 L165P probably damaging Het
Casz1 G A 4: 148,929,236 A86T probably damaging Het
Cd1d2 T C 3: 86,987,773 F189L probably benign Het
Cep72 A G 13: 74,058,325 M126T probably damaging Het
Cep85l T A 10: 53,298,199 T483S probably damaging Het
Cfi C A 3: 129,872,873 T415K probably damaging Het
Chrna7 A G 7: 63,106,039 L253S probably damaging Het
Col4a4 T C 1: 82,497,330 H596R unknown Het
Cyp2j8 A T 4: 96,447,351 M402K probably benign Het
Cyp3a16 T A 5: 145,463,170 probably null Het
Dhdh T C 7: 45,475,274 K332E possibly damaging Het
Dnah11 C A 12: 118,017,661 C2590F probably damaging Het
Dnah17 T C 11: 118,025,702 probably null Het
Dtx1 A G 5: 120,695,083 Y97H probably damaging Het
Elf1 A G 14: 79,570,768 D183G probably damaging Het
Esyt3 A C 9: 99,322,153 L94R probably damaging Het
Exoc3 A G 13: 74,182,166 Y521H probably benign Het
F5 C T 1: 164,179,506 T293M probably damaging Het
Fam118b A T 9: 35,235,264 H102Q probably damaging Het
Flad1 T C 3: 89,402,242 probably benign Het
Flrt3 G A 2: 140,660,884 R275* probably null Het
Fndc7 G A 3: 108,876,648 A215V probably benign Het
Fscn1 T A 5: 142,960,627 V60E probably damaging Het
Gm17175 A T 14: 51,573,961 M1K probably null Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Gprc6a T C 10: 51,615,047 S694G probably benign Het
Iglon5 A T 7: 43,476,830 probably null Het
Iqch T C 9: 63,454,610 T874A probably benign Het
Lamc2 T A 1: 153,166,127 H87L possibly damaging Het
Ldlrad1 T A 4: 107,209,580 D37E probably benign Het
Lman1l G C 9: 57,615,948 Q109E probably benign Het
Loxhd1 T C 18: 77,372,433 probably null Het
Lxn T G 3: 67,462,371 E60D probably benign Het
Man2b2 A G 5: 36,821,869 W276R probably damaging Het
Mast1 T C 8: 84,928,969 Y182C probably damaging Het
Mroh8 C T 2: 157,216,977 R923Q probably benign Het
Nov A T 15: 54,752,347 T303S probably damaging Het
Obscn A G 11: 59,136,038 L113P probably damaging Het
Ocln C T 13: 100,534,962 probably null Het
Olfr1467 A G 19: 13,364,623 probably benign Het
Oog2 A T 4: 144,195,327 Q269L probably damaging Het
Osbpl3 A G 6: 50,297,157 S826P probably damaging Het
Otogl T C 10: 107,779,831 N1869S probably benign Het
Pamr1 G A 2: 102,611,623 D186N probably damaging Het
Pcdhga8 T A 18: 37,726,893 I334K probably benign Het
Pde7b A G 10: 20,443,292 S95P probably damaging Het
Pik3cg A T 12: 32,192,129 V994E probably damaging Het
Pkp1 T C 1: 135,889,954 M148V probably benign Het
Plbd1 T G 6: 136,612,838 K461Q probably benign Het
Pmfbp1 A G 8: 109,530,589 E594G possibly damaging Het
Pold3 A T 7: 100,106,658 H60Q probably damaging Het
Polr3gl C T 3: 96,580,467 R52Q possibly damaging Het
Ptgds A G 2: 25,467,816 probably null Het
Scarb2 T C 5: 92,454,075 D320G probably benign Het
Sdk2 T C 11: 113,803,169 Y1812C probably damaging Het
Skint8 C A 4: 111,937,025 T204N probably benign Het
Slc23a2 T C 2: 132,094,203 Q49R possibly damaging Het
Slc26a7 T C 4: 14,552,476 Q227R probably benign Het
Sntn C T 14: 13,679,108 T94I probably damaging Het
Spem2 C T 11: 69,817,756 G128S probably benign Het
Supt16 A T 14: 52,171,450 S822R probably damaging Het
Syn3 T C 10: 86,080,252 Y290C probably damaging Het
Tdrd6 C G 17: 43,627,708 E816D probably benign Het
Tln1 A T 4: 43,556,302 M72K probably damaging Het
Tlnrd1 A G 7: 83,882,779 V148A probably damaging Het
Trim24 C A 6: 37,958,678 T832K probably benign Het
Ubr4 C T 4: 139,414,404 A1267V probably damaging Het
Usp17lb A T 7: 104,841,285 M145K probably damaging Het
Vmn1r178 T A 7: 23,894,337 M270K probably benign Het
Vmn2r70 A T 7: 85,559,611 C553S probably damaging Het
Vps37c G T 19: 10,710,329 E51D probably damaging Het
Zfp62 T G 11: 49,216,379 Y432* probably null Het
Other mutations in Olfr671
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Olfr671 APN 7 104975986 unclassified probably null
IGL02154:Olfr671 APN 7 104975981 start codon destroyed probably null 0.14
IGL02308:Olfr671 APN 7 104975458 missense possibly damaging 0.84
IGL02794:Olfr671 APN 7 104975389 missense probably benign
R0919:Olfr671 UTSW 7 104975312 nonsense probably null
R1819:Olfr671 UTSW 7 104975398 missense probably benign 0.01
R1972:Olfr671 UTSW 7 104975899 missense possibly damaging 0.63
R2025:Olfr671 UTSW 7 104975244 missense probably benign 0.01
R4910:Olfr671 UTSW 7 104975479 missense possibly damaging 0.88
R5442:Olfr671 UTSW 7 104975228 missense possibly damaging 0.80
R5554:Olfr671 UTSW 7 104975982 start codon destroyed probably null 0.99
R5932:Olfr671 UTSW 7 104975655 missense probably damaging 1.00
R6683:Olfr671 UTSW 7 104975968 missense probably benign
R6962:Olfr671 UTSW 7 104975373 missense probably benign 0.00
R7059:Olfr671 UTSW 7 104976017 splice site probably null
R7276:Olfr671 UTSW 7 104975650 missense possibly damaging 0.62
R7425:Olfr671 UTSW 7 104975061 nonsense probably null
R7688:Olfr671 UTSW 7 104975125 missense possibly damaging 0.60
R8043:Olfr671 UTSW 7 104975873 nonsense probably null
R8074:Olfr671 UTSW 7 104975727 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCAGTTTTCTATGGACTAGACAC -3'
(R):5'- GCTCTCTTGCTCCTGGATGTAG -3'

Sequencing Primer
(F):5'- TTTCTATGGACTAGACACAAAACAAC -3'
(R):5'- CTATGTCAGGATCCTCTATGCAGTG -3'
Posted On2019-05-13