Incidental Mutation 'R7000:Gprc6a'
ID544488
Institutional Source Beutler Lab
Gene Symbol Gprc6a
Ensembl Gene ENSMUSG00000019905
Gene NameG protein-coupled receptor, family C, group 6, member A
Synonyms
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_153071.1; MGI:2429498

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7000 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location51614823-51631461 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 51615047 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 694 (S694G)
Ref Sequence ENSEMBL: ENSMUSP00000152031 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020062] [ENSMUST00000218684] [ENSMUST00000219286]
Predicted Effect probably benign
Transcript: ENSMUST00000020062
AA Change: S869G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000020062
Gene: ENSMUSG00000019905
AA Change: S869G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 73 482 2.3e-62 PFAM
Pfam:NCD3G 519 572 5.9e-18 PFAM
Pfam:7tm_3 600 838 2e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218684
AA Change: S694G

PolyPhen 2 Score 0.341 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000219286
AA Change: S798G

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype Strain: 3831176
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of family C of the G protein-coupled receptor (GPCR) superfamily, such as GPRC6A, are characterized by an evolutionarily conserved amino acid-sensing motif linked to an intramembranous 7-transmembrane loop region. Several members of GPCR family C, including GPRC6A, also have a long N-terminal domain (summary by Pi et al., 2005 [PubMed 16199532]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a knock-out allele show a metabolic syndrome characterized by impaired bone mineralization, increased fat mass, abnormal renal handling of calcium and phosphorus, fatty liver, glucose intolerance, testicular feminization and abnormal steroidogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a G A 5: 8,702,823 A525T probably benign Het
Abcc6 A G 7: 46,005,522 I515T possibly damaging Het
Abi1 G A 2: 22,942,041 A420V probably damaging Het
Abtb2 A T 2: 103,712,442 I887F possibly damaging Het
Acap3 G A 4: 155,903,849 G602S possibly damaging Het
Auts2 T A 5: 131,440,218 T754S probably benign Het
AW551984 T C 9: 39,600,789 R12G probably benign Het
AW822073 T C 10: 58,222,992 T647A possibly damaging Het
Bcan G A 3: 87,988,379 R817* probably null Het
Bmp10 A G 6: 87,434,193 T323A probably benign Het
Bpnt1 T C 1: 185,349,856 L165P probably damaging Het
Casz1 G A 4: 148,929,236 A86T probably damaging Het
Cd1d2 T C 3: 86,987,773 F189L probably benign Het
Cep72 A G 13: 74,058,325 M126T probably damaging Het
Cep85l T A 10: 53,298,199 T483S probably damaging Het
Cfi C A 3: 129,872,873 T415K probably damaging Het
Chrna7 A G 7: 63,106,039 L253S probably damaging Het
Col4a4 T C 1: 82,497,330 H596R unknown Het
Cyp2j8 A T 4: 96,447,351 M402K probably benign Het
Cyp3a16 T A 5: 145,463,170 probably null Het
Dhdh T C 7: 45,475,274 K332E possibly damaging Het
Dnah11 C A 12: 118,017,661 C2590F probably damaging Het
Dnah17 T C 11: 118,025,702 probably null Het
Dtx1 A G 5: 120,695,083 Y97H probably damaging Het
Elf1 A G 14: 79,570,768 D183G probably damaging Het
Esyt3 A C 9: 99,322,153 L94R probably damaging Het
Exoc3 A G 13: 74,182,166 Y521H probably benign Het
F5 C T 1: 164,179,506 T293M probably damaging Het
Fam118b A T 9: 35,235,264 H102Q probably damaging Het
Flad1 T C 3: 89,402,242 probably benign Het
Flrt3 G A 2: 140,660,884 R275* probably null Het
Fndc7 G A 3: 108,876,648 A215V probably benign Het
Fscn1 T A 5: 142,960,627 V60E probably damaging Het
Gm17175 A T 14: 51,573,961 M1K probably null Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Iglon5 A T 7: 43,476,830 probably null Het
Iqch T C 9: 63,454,610 T874A probably benign Het
Lamc2 T A 1: 153,166,127 H87L possibly damaging Het
Ldlrad1 T A 4: 107,209,580 D37E probably benign Het
Lman1l G C 9: 57,615,948 Q109E probably benign Het
Loxhd1 T C 18: 77,372,433 probably null Het
Lxn T G 3: 67,462,371 E60D probably benign Het
Man2b2 A G 5: 36,821,869 W276R probably damaging Het
Mast1 T C 8: 84,928,969 Y182C probably damaging Het
Mroh8 C T 2: 157,216,977 R923Q probably benign Het
Nov A T 15: 54,752,347 T303S probably damaging Het
Obscn A G 11: 59,136,038 L113P probably damaging Het
Ocln C T 13: 100,534,962 probably null Het
Olfr1467 A G 19: 13,364,623 probably benign Het
Olfr671 G A 7: 104,975,131 P285S probably damaging Het
Oog2 A T 4: 144,195,327 Q269L probably damaging Het
Osbpl3 A G 6: 50,297,157 S826P probably damaging Het
Otogl T C 10: 107,779,831 N1869S probably benign Het
Pamr1 G A 2: 102,611,623 D186N probably damaging Het
Pcdhga8 T A 18: 37,726,893 I334K probably benign Het
Pde7b A G 10: 20,443,292 S95P probably damaging Het
Pik3cg A T 12: 32,192,129 V994E probably damaging Het
Pkp1 T C 1: 135,889,954 M148V probably benign Het
Plbd1 T G 6: 136,612,838 K461Q probably benign Het
Pmfbp1 A G 8: 109,530,589 E594G possibly damaging Het
Pold3 A T 7: 100,106,658 H60Q probably damaging Het
Polr3gl C T 3: 96,580,467 R52Q possibly damaging Het
Ptgds A G 2: 25,467,816 probably null Het
Scarb2 T C 5: 92,454,075 D320G probably benign Het
Sdk2 T C 11: 113,803,169 Y1812C probably damaging Het
Skint8 C A 4: 111,937,025 T204N probably benign Het
Slc23a2 T C 2: 132,094,203 Q49R possibly damaging Het
Slc26a7 T C 4: 14,552,476 Q227R probably benign Het
Sntn C T 14: 13,679,108 T94I probably damaging Het
Spem2 C T 11: 69,817,756 G128S probably benign Het
Supt16 A T 14: 52,171,450 S822R probably damaging Het
Syn3 T C 10: 86,080,252 Y290C probably damaging Het
Tdrd6 C G 17: 43,627,708 E816D probably benign Het
Tln1 A T 4: 43,556,302 M72K probably damaging Het
Tlnrd1 A G 7: 83,882,779 V148A probably damaging Het
Trim24 C A 6: 37,958,678 T832K probably benign Het
Ubr4 C T 4: 139,414,404 A1267V probably damaging Het
Usp17lb A T 7: 104,841,285 M145K probably damaging Het
Vmn1r178 T A 7: 23,894,337 M270K probably benign Het
Vmn2r70 A T 7: 85,559,611 C553S probably damaging Het
Vps37c G T 19: 10,710,329 E51D probably damaging Het
Zfp62 T G 11: 49,216,379 Y432* probably null Het
Other mutations in Gprc6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Gprc6a APN 10 51615430 missense probably damaging 1.00
IGL01640:Gprc6a APN 10 51627084 missense probably damaging 0.99
IGL02122:Gprc6a APN 10 51626723 missense probably benign
IGL02317:Gprc6a APN 10 51620953 missense probably benign 0.01
IGL02995:Gprc6a APN 10 51626799 missense probably damaging 1.00
IGL03229:Gprc6a APN 10 51616603 missense probably damaging 1.00
IGL03256:Gprc6a APN 10 51628349 missense possibly damaging 0.77
IGL03290:Gprc6a APN 10 51615872 missense probably damaging 1.00
IGL03393:Gprc6a APN 10 51615259 missense probably damaging 1.00
R0040:Gprc6a UTSW 10 51614984 nonsense probably null
R0040:Gprc6a UTSW 10 51614984 nonsense probably null
R0050:Gprc6a UTSW 10 51615389 missense probably damaging 1.00
R0050:Gprc6a UTSW 10 51615389 missense probably damaging 1.00
R1495:Gprc6a UTSW 10 51628437 missense probably benign 0.01
R1831:Gprc6a UTSW 10 51615806 missense probably benign 0.22
R2108:Gprc6a UTSW 10 51615208 missense probably damaging 1.00
R2159:Gprc6a UTSW 10 51615680 frame shift probably null
R2160:Gprc6a UTSW 10 51615680 frame shift probably null
R2162:Gprc6a UTSW 10 51615680 frame shift probably null
R2229:Gprc6a UTSW 10 51626795 missense possibly damaging 0.50
R3009:Gprc6a UTSW 10 51628296 missense probably benign 0.02
R3709:Gprc6a UTSW 10 51615680 frame shift probably null
R3710:Gprc6a UTSW 10 51615680 frame shift probably null
R3737:Gprc6a UTSW 10 51626911 missense probably benign
R3914:Gprc6a UTSW 10 51628275 missense probably benign 0.00
R3918:Gprc6a UTSW 10 51615680 frame shift probably null
R3964:Gprc6a UTSW 10 51615680 frame shift probably null
R3965:Gprc6a UTSW 10 51615680 frame shift probably null
R3966:Gprc6a UTSW 10 51615680 frame shift probably null
R3973:Gprc6a UTSW 10 51628448 missense possibly damaging 0.93
R3977:Gprc6a UTSW 10 51621101 missense probably benign 0.18
R3978:Gprc6a UTSW 10 51621101 missense probably benign 0.18
R3979:Gprc6a UTSW 10 51621101 missense probably benign 0.18
R4306:Gprc6a UTSW 10 51616639 missense probably damaging 1.00
R4404:Gprc6a UTSW 10 51628543 missense probably benign 0.09
R4405:Gprc6a UTSW 10 51628543 missense probably benign 0.09
R4408:Gprc6a UTSW 10 51628543 missense probably benign 0.09
R4713:Gprc6a UTSW 10 51631457 unclassified probably benign
R4788:Gprc6a UTSW 10 51615008 missense probably benign 0.00
R5248:Gprc6a UTSW 10 51614993 missense probably damaging 1.00
R5263:Gprc6a UTSW 10 51626804 missense probably damaging 1.00
R5436:Gprc6a UTSW 10 51626702 missense probably benign
R5721:Gprc6a UTSW 10 51614980 missense probably benign 0.06
R6061:Gprc6a UTSW 10 51615811 missense probably damaging 1.00
R6092:Gprc6a UTSW 10 51615077 missense probably damaging 1.00
R6132:Gprc6a UTSW 10 51615260 missense possibly damaging 0.89
R6162:Gprc6a UTSW 10 51614912 missense probably benign 0.44
R6207:Gprc6a UTSW 10 51626835 missense probably benign 0.36
R6497:Gprc6a UTSW 10 51615701 missense probably benign 0.05
R6717:Gprc6a UTSW 10 51615137 missense probably damaging 1.00
R6789:Gprc6a UTSW 10 51631316 missense probably damaging 1.00
R6807:Gprc6a UTSW 10 51626745 nonsense probably null
R7019:Gprc6a UTSW 10 51631412 missense possibly damaging 0.68
R7143:Gprc6a UTSW 10 51614890 missense probably benign
R7173:Gprc6a UTSW 10 51628499 missense probably benign 0.01
R7579:Gprc6a UTSW 10 51626787 missense probably benign
R7736:Gprc6a UTSW 10 51615453 missense possibly damaging 0.82
R7920:Gprc6a UTSW 10 51614930 missense probably benign 0.02
R8273:Gprc6a UTSW 10 51631274 missense probably benign
R8329:Gprc6a UTSW 10 51627259 nonsense probably null
R8517:Gprc6a UTSW 10 51631241 missense probably benign 0.00
R8723:Gprc6a UTSW 10 51615422 missense probably damaging 1.00
R8815:Gprc6a UTSW 10 51620983 missense probably benign 0.00
Z1177:Gprc6a UTSW 10 51615209 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCGTCTCCTAGGAACTCAATC -3'
(R):5'- TGTCTATACTACCACATTCGGC -3'

Sequencing Primer
(F):5'- CGTCTCCTAGGAACTCAATCATATAC -3'
(R):5'- CTACCACATTCGGCAAGTATTTG -3'
Posted On2019-05-13