Incidental Mutation 'R7001:Sf3b1'
ID544514
Institutional Source Beutler Lab
Gene Symbol Sf3b1
Ensembl Gene ENSMUSG00000025982
Gene Namesplicing factor 3b, subunit 1
SynonymsTarg4, SAP155, Prp10, 2810001M05Rik, SF3b155
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7001 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location54985169-55027481 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55001046 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 591 (V591A)
Ref Sequence ENSEMBL: ENSMUSP00000027127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027127]
Predicted Effect probably damaging
Transcript: ENSMUST00000027127
AA Change: V591A

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000027127
Gene: ENSMUSG00000025982
AA Change: V591A

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 65 75 N/A INTRINSIC
internal_repeat_1 185 276 1.77e-12 PROSPERO
Pfam:SF3b1 329 452 1.2e-51 PFAM
SCOP:d1qbkb_ 489 1289 5e-62 SMART
Blast:ARM 593 637 6e-13 BLAST
Blast:ARM 1005 1044 7e-14 BLAST
Meta Mutation Damage Score 0.8568 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes subunit 1 of the splicing factor 3b protein complex. Splicing factor 3b, together with splicing factor 3a and a 12S RNA unit, forms the U2 small nuclear ribonucleoproteins complex (U2 snRNP). The splicing factor 3b/3a complex binds pre-mRNA upstream of the intron's branch site in a sequence independent manner and may anchor the U2 snRNP to the pre-mRNA. Splicing factor 3b is also a component of the minor U12-type spliceosome. The carboxy-terminal two-thirds of subunit 1 have 22 non-identical, tandem HEAT repeats that form rod-like, helical structures. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos die around the 16- to 32-cell stage. Heterozygous mice exhibit various skeletal transformations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C A 3: 138,065,511 Q154K probably benign Het
Aldh6a1 T G 12: 84,441,888 T75P probably damaging Het
Ank2 T A 3: 127,077,581 H98L probably damaging Het
Ankib1 A G 5: 3,694,781 F800S probably benign Het
Arhgap10 A T 8: 77,365,088 M434K possibly damaging Het
Cap1 A T 4: 122,864,615 F257L probably benign Het
Cdt1 T A 8: 122,572,510 H510Q probably damaging Het
Clca3b A C 3: 144,827,972 D547E possibly damaging Het
Col24a1 T C 3: 145,298,866 V35A probably benign Het
Cyp2j13 A T 4: 96,056,875 N305K probably damaging Het
D3Ertd751e T A 3: 41,758,409 probably null Het
D6Ertd527e G A 6: 87,111,212 G119D unknown Het
Ddc T C 11: 11,824,870 probably null Het
Dnah12 A T 14: 26,879,724 Y3713F probably damaging Het
Dock8 T A 19: 25,099,677 S504T probably benign Het
Farp2 T C 1: 93,620,184 F941L possibly damaging Het
Farp2 A G 1: 93,620,230 N956S possibly damaging Het
Fbxo3 T A 2: 104,051,224 H300Q probably damaging Het
Fcgrt T C 7: 45,102,042 T131A probably benign Het
Fndc7 G A 3: 108,876,648 A215V probably benign Het
Frem1 T C 4: 82,986,561 E890G probably benign Het
Fsip2 C A 2: 82,986,925 P4334H probably damaging Het
Gcdh C A 8: 84,890,911 V227L probably benign Het
Gm8267 A C 14: 44,722,928 M120R possibly damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Lasp1 T G 11: 97,806,833 H26Q probably damaging Het
Lrrcc1 T A 3: 14,540,095 I297N probably damaging Het
Map1b A T 13: 99,430,593 N1873K unknown Het
Map2 A G 1: 66,415,487 I1179V probably benign Het
Mtss1 A C 15: 58,948,334 probably benign Het
Mtus2 A G 5: 148,277,628 E28G probably damaging Het
Muc6 G A 7: 141,637,407 T2386I probably damaging Het
Myo3a G T 2: 22,332,377 V362L probably benign Het
N6amt1 G A 16: 87,354,292 V14M probably benign Het
Nav1 A T 1: 135,454,611 probably null Het
Nol6 A G 4: 41,121,279 S326P probably benign Het
Olfr1084 A T 2: 86,639,151 S186T probably benign Het
Olfr599 A G 7: 103,338,221 S56G possibly damaging Het
Olr1 T A 6: 129,488,111 E100V probably damaging Het
Otop3 T C 11: 115,339,653 Y119H probably damaging Het
Prpmp5 C T 6: 132,312,564 G99E unknown Het
Ryr2 A T 13: 11,794,605 M778K probably damaging Het
Serpina3n G T 12: 104,408,925 M85I probably benign Het
Serpine2 A G 1: 79,795,031 F390L probably damaging Het
Slc26a5 C T 5: 21,811,336 V646I probably damaging Het
Slitrk3 T A 3: 73,050,609 K277* probably null Het
Sv2c A G 13: 95,981,953 S463P probably benign Het
Tbc1d4 G A 14: 101,458,749 T858M probably benign Het
Tbx18 T A 9: 87,727,404 I193F probably damaging Het
Tm6sf2 A C 8: 70,078,332 D245A probably damaging Het
Unc119 T C 11: 78,348,554 Y234H probably damaging Het
Wrn A T 8: 33,352,129 S46T probably benign Het
Zfp729a A T 13: 67,620,349 I587K probably benign Het
Zfp872 C A 9: 22,200,616 H464N probably damaging Het
Other mutations in Sf3b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Sf3b1 APN 1 54987486 missense probably damaging 1.00
IGL00815:Sf3b1 APN 1 54996931 splice site probably benign
IGL01380:Sf3b1 APN 1 54987949 missense probably damaging 1.00
IGL01390:Sf3b1 APN 1 54987429 missense probably benign 0.17
IGL02974:Sf3b1 APN 1 55007707 missense probably benign 0.00
IGL03159:Sf3b1 APN 1 55012213 missense probably benign
Colt UTSW 1 54997156 missense probably benign 0.45
Glock UTSW 1 55001046 missense probably damaging 0.96
Handgun UTSW 1 55007507 missense probably damaging 1.00
Kalashnikov UTSW 1 55019265 missense probably damaging 0.99
Magazine UTSW 1 55012182 nonsense probably null
Revolver UTSW 1 55019389 nonsense probably null
R0053:Sf3b1 UTSW 1 55000373 nonsense probably null
R0053:Sf3b1 UTSW 1 55000373 nonsense probably null
R0190:Sf3b1 UTSW 1 54990306 missense probably damaging 0.99
R0277:Sf3b1 UTSW 1 55019257 missense probably damaging 0.99
R0323:Sf3b1 UTSW 1 55019257 missense probably damaging 0.99
R0369:Sf3b1 UTSW 1 54998108 missense probably benign 0.10
R0396:Sf3b1 UTSW 1 55019271 missense probably damaging 1.00
R0718:Sf3b1 UTSW 1 55019385 missense probably damaging 0.99
R0991:Sf3b1 UTSW 1 55019395 missense possibly damaging 0.89
R1082:Sf3b1 UTSW 1 55019395 missense possibly damaging 0.89
R1083:Sf3b1 UTSW 1 55019395 missense possibly damaging 0.89
R1084:Sf3b1 UTSW 1 55019395 missense possibly damaging 0.89
R1196:Sf3b1 UTSW 1 55019395 missense possibly damaging 0.89
R1376:Sf3b1 UTSW 1 55019265 missense probably damaging 0.99
R1376:Sf3b1 UTSW 1 55019265 missense probably damaging 0.99
R1381:Sf3b1 UTSW 1 55003154 missense probably damaging 0.99
R1436:Sf3b1 UTSW 1 55001421 missense possibly damaging 0.72
R1559:Sf3b1 UTSW 1 55019395 missense possibly damaging 0.89
R1560:Sf3b1 UTSW 1 55019395 missense possibly damaging 0.89
R1561:Sf3b1 UTSW 1 55019395 missense possibly damaging 0.89
R1567:Sf3b1 UTSW 1 55019395 missense possibly damaging 0.89
R1568:Sf3b1 UTSW 1 55019395 missense possibly damaging 0.89
R1588:Sf3b1 UTSW 1 54997177 missense probably benign 0.05
R1625:Sf3b1 UTSW 1 55019377 missense probably damaging 1.00
R1694:Sf3b1 UTSW 1 55019395 missense possibly damaging 0.89
R1735:Sf3b1 UTSW 1 55000652 missense probably damaging 1.00
R1900:Sf3b1 UTSW 1 54998188 missense possibly damaging 0.75
R2186:Sf3b1 UTSW 1 55007633 missense probably benign
R2429:Sf3b1 UTSW 1 55016801 missense possibly damaging 0.71
R2473:Sf3b1 UTSW 1 54999626 critical splice donor site probably null
R3772:Sf3b1 UTSW 1 54999991 intron probably benign
R3911:Sf3b1 UTSW 1 55019389 nonsense probably null
R3970:Sf3b1 UTSW 1 55012182 nonsense probably null
R4706:Sf3b1 UTSW 1 54990507 missense probably damaging 1.00
R4707:Sf3b1 UTSW 1 54990507 missense probably damaging 1.00
R4964:Sf3b1 UTSW 1 54999712 missense probably benign
R5053:Sf3b1 UTSW 1 54997177 missense probably benign 0.05
R5358:Sf3b1 UTSW 1 55003310 missense probably benign 0.09
R5379:Sf3b1 UTSW 1 55003150 missense possibly damaging 0.94
R5628:Sf3b1 UTSW 1 54998175 missense probably benign 0.27
R5636:Sf3b1 UTSW 1 54997193 missense probably damaging 1.00
R6013:Sf3b1 UTSW 1 55000298 missense probably damaging 0.98
R6149:Sf3b1 UTSW 1 55007507 missense probably damaging 1.00
R6217:Sf3b1 UTSW 1 55007518 missense probably damaging 1.00
R6426:Sf3b1 UTSW 1 54999655 missense probably benign 0.01
R6531:Sf3b1 UTSW 1 55019395 missense probably damaging 0.99
R6945:Sf3b1 UTSW 1 54997156 missense probably benign 0.45
R7001:Sf3b1 UTSW 1 55014481 critical splice donor site probably null
R7302:Sf3b1 UTSW 1 55016790 missense probably benign 0.00
R7644:Sf3b1 UTSW 1 54997143 nonsense probably null
R7664:Sf3b1 UTSW 1 54987467 missense probably damaging 1.00
R7735:Sf3b1 UTSW 1 55003349 missense probably benign 0.29
R7809:Sf3b1 UTSW 1 54995455 missense possibly damaging 0.60
R8516:Sf3b1 UTSW 1 55012103 missense probably null 0.01
R8871:Sf3b1 UTSW 1 54990349 missense probably damaging 1.00
R8947:Sf3b1 UTSW 1 55000285 missense probably damaging 1.00
Z1177:Sf3b1 UTSW 1 55003402 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTGTTTCGGACATATTCATCCATG -3'
(R):5'- TGGAATCTGGAAGTTGTTACTTTCC -3'

Sequencing Primer
(F):5'- TTCGGACATATTCATCCATGTTATC -3'
(R):5'- TGACCTGGAACTTAGTCCAGG -3'
Posted On2019-05-13