Incidental Mutation 'R7001:Lrrcc1'
ID544524
Institutional Source Beutler Lab
Gene Symbol Lrrcc1
Ensembl Gene ENSMUSG00000027550
Gene Nameleucine rich repeat and coiled-coil domain containing 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7001 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location14533788-14572658 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 14540095 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 297 (I297N)
Ref Sequence ENSEMBL: ENSMUSP00000126560 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091325] [ENSMUST00000108370] [ENSMUST00000163660] [ENSMUST00000165436] [ENSMUST00000169079]
Predicted Effect probably benign
Transcript: ENSMUST00000091325
SMART Domains Protein: ENSMUSP00000088875
Gene: ENSMUSG00000027550

DomainStartEndE-ValueType
Pfam:LRR_8 60 116 1.1e-9 PFAM
Pfam:LRR_4 82 126 4.8e-8 PFAM
Blast:LRR 130 151 1e-5 BLAST
coiled coil region 412 626 N/A INTRINSIC
coiled coil region 675 718 N/A INTRINSIC
coiled coil region 757 1010 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108370
AA Change: I297N

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104007
Gene: ENSMUSG00000027550
AA Change: I297N

DomainStartEndE-ValueType
Pfam:LRR_8 60 116 1.1e-9 PFAM
Pfam:LRR_4 82 124 4.5e-8 PFAM
Blast:LRR 130 151 1e-5 BLAST
low complexity region 289 301 N/A INTRINSIC
coiled coil region 428 642 N/A INTRINSIC
coiled coil region 691 734 N/A INTRINSIC
coiled coil region 773 953 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163660
AA Change: I175N

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128733
Gene: ENSMUSG00000027550
AA Change: I175N

DomainStartEndE-ValueType
Blast:LRR 8 29 7e-6 BLAST
SCOP:d1dcea3 9 71 9e-4 SMART
low complexity region 167 179 N/A INTRINSIC
coiled coil region 306 520 N/A INTRINSIC
coiled coil region 569 612 N/A INTRINSIC
coiled coil region 651 716 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165436
SMART Domains Protein: ENSMUSP00000129430
Gene: ENSMUSG00000027550

DomainStartEndE-ValueType
Pfam:LRR_9 32 154 4e-10 PFAM
Pfam:LRR_6 60 83 1.4e-4 PFAM
Pfam:LRR_4 60 103 6.2e-11 PFAM
Pfam:LRR_8 60 116 8.1e-11 PFAM
Pfam:LRR_1 61 81 3.3e-4 PFAM
Pfam:LRR_6 78 105 3.4e-3 PFAM
Pfam:LRR_4 82 125 4.9e-9 PFAM
Pfam:LRR_6 103 125 5.1e-4 PFAM
Pfam:LRR_4 104 149 1.2e-8 PFAM
Pfam:LRR_1 105 128 3.8e-3 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000169079
AA Change: I297N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126560
Gene: ENSMUSG00000027550
AA Change: I297N

DomainStartEndE-ValueType
Pfam:LRR_4 60 102 4.3e-9 PFAM
internal_repeat_1 109 145 1.05e-6 PROSPERO
low complexity region 289 301 N/A INTRINSIC
coiled coil region 428 642 N/A INTRINSIC
coiled coil region 691 734 N/A INTRINSIC
coiled coil region 773 1026 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C A 3: 138,065,511 Q154K probably benign Het
Aldh6a1 T G 12: 84,441,888 T75P probably damaging Het
Ank2 T A 3: 127,077,581 H98L probably damaging Het
Ankib1 A G 5: 3,694,781 F800S probably benign Het
Arhgap10 A T 8: 77,365,088 M434K possibly damaging Het
Cap1 A T 4: 122,864,615 F257L probably benign Het
Cdt1 T A 8: 122,572,510 H510Q probably damaging Het
Clca3b A C 3: 144,827,972 D547E possibly damaging Het
Col24a1 T C 3: 145,298,866 V35A probably benign Het
Cyp2j13 A T 4: 96,056,875 N305K probably damaging Het
D3Ertd751e T A 3: 41,758,409 probably null Het
D6Ertd527e G A 6: 87,111,212 G119D unknown Het
Ddc T C 11: 11,824,870 probably null Het
Dnah12 A T 14: 26,879,724 Y3713F probably damaging Het
Dock8 T A 19: 25,099,677 S504T probably benign Het
Farp2 T C 1: 93,620,184 F941L possibly damaging Het
Farp2 A G 1: 93,620,230 N956S possibly damaging Het
Fbxo3 T A 2: 104,051,224 H300Q probably damaging Het
Fcgrt T C 7: 45,102,042 T131A probably benign Het
Fndc7 G A 3: 108,876,648 A215V probably benign Het
Frem1 T C 4: 82,986,561 E890G probably benign Het
Fsip2 C A 2: 82,986,925 P4334H probably damaging Het
Gcdh C A 8: 84,890,911 V227L probably benign Het
Gm8267 A C 14: 44,722,928 M120R possibly damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Lasp1 T G 11: 97,806,833 H26Q probably damaging Het
Map1b A T 13: 99,430,593 N1873K unknown Het
Map2 A G 1: 66,415,487 I1179V probably benign Het
Mtss1 A C 15: 58,948,334 probably benign Het
Mtus2 A G 5: 148,277,628 E28G probably damaging Het
Muc6 G A 7: 141,637,407 T2386I probably damaging Het
Myo3a G T 2: 22,332,377 V362L probably benign Het
N6amt1 G A 16: 87,354,292 V14M probably benign Het
Nav1 A T 1: 135,454,611 probably null Het
Nol6 A G 4: 41,121,279 S326P probably benign Het
Olfr1084 A T 2: 86,639,151 S186T probably benign Het
Olfr599 A G 7: 103,338,221 S56G possibly damaging Het
Olr1 T A 6: 129,488,111 E100V probably damaging Het
Otop3 T C 11: 115,339,653 Y119H probably damaging Het
Prpmp5 C T 6: 132,312,564 G99E unknown Het
Ryr2 A T 13: 11,794,605 M778K probably damaging Het
Serpina3n G T 12: 104,408,925 M85I probably benign Het
Serpine2 A G 1: 79,795,031 F390L probably damaging Het
Sf3b1 A G 1: 55,001,046 V591A probably damaging Het
Sf3b1 A G 1: 55,014,481 probably null Het
Slc26a5 C T 5: 21,811,336 V646I probably damaging Het
Slitrk3 T A 3: 73,050,609 K277* probably null Het
Sv2c A G 13: 95,981,953 S463P probably benign Het
Tbc1d4 G A 14: 101,458,749 T858M probably benign Het
Tbx18 T A 9: 87,727,404 I193F probably damaging Het
Tm6sf2 A C 8: 70,078,332 D245A probably damaging Het
Unc119 T C 11: 78,348,554 Y234H probably damaging Het
Wrn A T 8: 33,352,129 S46T probably benign Het
Zfp729a A T 13: 67,620,349 I587K probably benign Het
Zfp872 C A 9: 22,200,616 H464N probably damaging Het
Other mutations in Lrrcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Lrrcc1 APN 3 14536128 missense possibly damaging 0.91
IGL01325:Lrrcc1 APN 3 14536541 critical splice donor site probably null
IGL01681:Lrrcc1 APN 3 14548226 missense probably benign 0.35
IGL01767:Lrrcc1 APN 3 14547272 missense probably damaging 0.97
IGL01868:Lrrcc1 APN 3 14554357 nonsense probably null
IGL03123:Lrrcc1 APN 3 14536084 missense probably damaging 0.97
PIT1430001:Lrrcc1 UTSW 3 14545596 missense probably damaging 0.99
R0295:Lrrcc1 UTSW 3 14565849 missense probably benign 0.05
R0427:Lrrcc1 UTSW 3 14558356 missense probably damaging 1.00
R0433:Lrrcc1 UTSW 3 14559374 missense probably damaging 1.00
R0534:Lrrcc1 UTSW 3 14557273 missense probably damaging 1.00
R0631:Lrrcc1 UTSW 3 14540119 splice site probably benign
R0635:Lrrcc1 UTSW 3 14559228 missense probably benign 0.11
R1355:Lrrcc1 UTSW 3 14548114 missense probably benign 0.07
R1370:Lrrcc1 UTSW 3 14548114 missense probably benign 0.07
R1727:Lrrcc1 UTSW 3 14537363 missense probably damaging 0.99
R1822:Lrrcc1 UTSW 3 14559225 unclassified probably benign
R1946:Lrrcc1 UTSW 3 14550393 missense probably benign 0.02
R2254:Lrrcc1 UTSW 3 14547255 missense probably damaging 1.00
R2362:Lrrcc1 UTSW 3 14563024 missense probably damaging 1.00
R2392:Lrrcc1 UTSW 3 14536520 missense probably damaging 1.00
R4105:Lrrcc1 UTSW 3 14550328 missense probably benign 0.21
R4464:Lrrcc1 UTSW 3 14557318 missense probably damaging 1.00
R4484:Lrrcc1 UTSW 3 14551443 missense probably damaging 1.00
R4543:Lrrcc1 UTSW 3 14539791 missense probably damaging 0.98
R4718:Lrrcc1 UTSW 3 14536032 missense probably damaging 1.00
R4734:Lrrcc1 UTSW 3 14562285 missense probably damaging 1.00
R4799:Lrrcc1 UTSW 3 14536096 nonsense probably null
R4841:Lrrcc1 UTSW 3 14562511 missense probably benign 0.04
R4842:Lrrcc1 UTSW 3 14562511 missense probably benign 0.04
R5900:Lrrcc1 UTSW 3 14562126 missense possibly damaging 0.69
R6338:Lrrcc1 UTSW 3 14547316 missense possibly damaging 0.48
R7036:Lrrcc1 UTSW 3 14563009 missense possibly damaging 0.80
R7342:Lrrcc1 UTSW 3 14554371 missense probably benign
R8038:Lrrcc1 UTSW 3 14565830 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- TGATGATGTGTCAGCACCAC -3'
(R):5'- ACTCATGAAGGCAGGCAAC -3'

Sequencing Primer
(F):5'- CACCAATGGATGTGTTGCC -3'
(R):5'- TGAGTGAAAAACATCTCCCATTG -3'
Posted On2019-05-13