Incidental Mutation 'R7001:1110002E22Rik'
ID 544528
Institutional Source Beutler Lab
Gene Symbol 1110002E22Rik
Ensembl Gene ENSMUSG00000090066
Gene Name RIKEN cDNA 1110002E22 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.401) question?
Stock # R7001 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 138065052-138081506 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 138065511 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 154 (Q154K)
Ref Sequence ENSEMBL: ENSMUSP00000123851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053318] [ENSMUST00000163080]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000053318
Predicted Effect probably benign
Transcript: ENSMUST00000163080
AA Change: Q154K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123851
Gene: ENSMUSG00000090066
AA Change: Q154K

DomainStartEndE-ValueType
low complexity region 44 55 N/A INTRINSIC
low complexity region 87 102 N/A INTRINSIC
low complexity region 229 247 N/A INTRINSIC
low complexity region 422 438 N/A INTRINSIC
low complexity region 459 505 N/A INTRINSIC
low complexity region 667 680 N/A INTRINSIC
low complexity region 937 948 N/A INTRINSIC
low complexity region 995 1007 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
low complexity region 1224 1242 N/A INTRINSIC
low complexity region 1376 1385 N/A INTRINSIC
Pfam:DUF4585 1598 1667 6.9e-32 PFAM
low complexity region 1723 1738 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh6a1 T G 12: 84,441,888 T75P probably damaging Het
Ank2 T A 3: 127,077,581 H98L probably damaging Het
Ankib1 A G 5: 3,694,781 F800S probably benign Het
Arhgap10 A T 8: 77,365,088 M434K possibly damaging Het
Cap1 A T 4: 122,864,615 F257L probably benign Het
Cdt1 T A 8: 122,572,510 H510Q probably damaging Het
Clca3b A C 3: 144,827,972 D547E possibly damaging Het
Col24a1 T C 3: 145,298,866 V35A probably benign Het
Cyp2j13 A T 4: 96,056,875 N305K probably damaging Het
D3Ertd751e T A 3: 41,758,409 probably null Het
D6Ertd527e G A 6: 87,111,212 G119D unknown Het
Ddc T C 11: 11,824,870 probably null Het
Dnah12 A T 14: 26,879,724 Y3713F probably damaging Het
Dock8 T A 19: 25,099,677 S504T probably benign Het
Farp2 T C 1: 93,620,184 F941L possibly damaging Het
Farp2 A G 1: 93,620,230 N956S possibly damaging Het
Fbxo3 T A 2: 104,051,224 H300Q probably damaging Het
Fcgrt T C 7: 45,102,042 T131A probably benign Het
Fndc7 G A 3: 108,876,648 A215V probably benign Het
Frem1 T C 4: 82,986,561 E890G probably benign Het
Fsip2 C A 2: 82,986,925 P4334H probably damaging Het
Gcdh C A 8: 84,890,911 V227L probably benign Het
Gm8267 A C 14: 44,722,928 M120R possibly damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Lasp1 T G 11: 97,806,833 H26Q probably damaging Het
Lrrcc1 T A 3: 14,540,095 I297N probably damaging Het
Map1b A T 13: 99,430,593 N1873K unknown Het
Map2 A G 1: 66,415,487 I1179V probably benign Het
Mtss1 A C 15: 58,948,334 probably benign Het
Mtus2 A G 5: 148,277,628 E28G probably damaging Het
Muc6 G A 7: 141,637,407 T2386I probably damaging Het
Myo3a G T 2: 22,332,377 V362L probably benign Het
N6amt1 G A 16: 87,354,292 V14M probably benign Het
Nav1 A T 1: 135,454,611 probably null Het
Nol6 A G 4: 41,121,279 S326P probably benign Het
Olfr1084 A T 2: 86,639,151 S186T probably benign Het
Olfr599 A G 7: 103,338,221 S56G possibly damaging Het
Olr1 T A 6: 129,488,111 E100V probably damaging Het
Otop3 T C 11: 115,339,653 Y119H probably damaging Het
Prpmp5 C T 6: 132,312,564 G99E unknown Het
Ryr2 A T 13: 11,794,605 M778K probably damaging Het
Serpina3n G T 12: 104,408,925 M85I probably benign Het
Serpine2 A G 1: 79,795,031 F390L probably damaging Het
Sf3b1 A G 1: 55,001,046 V591A probably damaging Het
Sf3b1 A G 1: 55,014,481 probably null Het
Slc26a5 C T 5: 21,811,336 V646I probably damaging Het
Slitrk3 T A 3: 73,050,609 K277* probably null Het
Sv2c A G 13: 95,981,953 S463P probably benign Het
Tbc1d4 G A 14: 101,458,749 T858M probably benign Het
Tbx18 T A 9: 87,727,404 I193F probably damaging Het
Tm6sf2 A C 8: 70,078,332 D245A probably damaging Het
Unc119 T C 11: 78,348,554 Y234H probably damaging Het
Wrn A T 8: 33,352,129 S46T probably benign Het
Zfp729a A T 13: 67,620,349 I587K probably benign Het
Zfp872 C A 9: 22,200,616 H464N probably damaging Het
Other mutations in 1110002E22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0026:1110002E22Rik UTSW 3 138066805 missense possibly damaging 0.95
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0197:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0239:1110002E22Rik UTSW 3 138065834 small deletion probably benign
R0394:1110002E22Rik UTSW 3 138067304 missense probably damaging 0.99
R0401:1110002E22Rik UTSW 3 138070306 missense possibly damaging 0.73
R0496:1110002E22Rik UTSW 3 138068244 missense probably damaging 1.00
R0591:1110002E22Rik UTSW 3 138068943 nonsense probably null
R0711:1110002E22Rik UTSW 3 138068225 missense probably damaging 0.99
R0883:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0908:1110002E22Rik UTSW 3 138070077 missense probably damaging 0.99
R0968:1110002E22Rik UTSW 3 138067206 missense probably damaging 0.99
R1023:1110002E22Rik UTSW 3 138066871 missense probably damaging 1.00
R1168:1110002E22Rik UTSW 3 138067900 missense probably benign 0.20
R1472:1110002E22Rik UTSW 3 138067552 missense possibly damaging 0.95
R1538:1110002E22Rik UTSW 3 138065401 missense probably benign 0.02
R1648:1110002E22Rik UTSW 3 138069420 missense probably benign 0.18
R1800:1110002E22Rik UTSW 3 138066718 missense probably damaging 1.00
R1919:1110002E22Rik UTSW 3 138067270 missense probably damaging 0.99
R1974:1110002E22Rik UTSW 3 138067267 missense probably damaging 1.00
R1990:1110002E22Rik UTSW 3 138065658 nonsense probably null
R1991:1110002E22Rik UTSW 3 138065658 nonsense probably null
R2102:1110002E22Rik UTSW 3 138065173 missense probably damaging 0.99
R2761:1110002E22Rik UTSW 3 138067780 missense probably damaging 0.99
R2899:1110002E22Rik UTSW 3 138065682 missense probably benign 0.00
R3618:1110002E22Rik UTSW 3 138068407 missense probably damaging 1.00
R3904:1110002E22Rik UTSW 3 138066639 missense probably benign 0.15
R3955:1110002E22Rik UTSW 3 138068073 missense probably benign 0.00
R4520:1110002E22Rik UTSW 3 138070266 missense probably damaging 0.99
R4619:1110002E22Rik UTSW 3 138069759 missense probably damaging 0.99
R4736:1110002E22Rik UTSW 3 138068485 missense probably damaging 0.99
R4752:1110002E22Rik UTSW 3 138069990 missense possibly damaging 0.91
R4777:1110002E22Rik UTSW 3 138065742 missense probably benign 0.09
R4780:1110002E22Rik UTSW 3 138065370 missense probably benign 0.02
R4824:1110002E22Rik UTSW 3 138065676 missense probably benign 0.00
R4829:1110002E22Rik UTSW 3 138069019 missense probably damaging 0.99
R4965:1110002E22Rik UTSW 3 138069672 missense probably benign
R5206:1110002E22Rik UTSW 3 138066511 missense probably benign 0.00
R5212:1110002E22Rik UTSW 3 138065850 missense possibly damaging 0.85
R5373:1110002E22Rik UTSW 3 138067635 missense probably benign
R5374:1110002E22Rik UTSW 3 138067635 missense probably benign
R5506:1110002E22Rik UTSW 3 138067947 missense probably damaging 1.00
R5528:1110002E22Rik UTSW 3 138066499 missense probably benign
R5536:1110002E22Rik UTSW 3 138066388 missense possibly damaging 0.89
R5587:1110002E22Rik UTSW 3 138065409 missense probably benign
R5759:1110002E22Rik UTSW 3 138068658 missense probably benign
R5933:1110002E22Rik UTSW 3 138070348 missense probably damaging 1.00
R5957:1110002E22Rik UTSW 3 138070161 missense probably benign
R6092:1110002E22Rik UTSW 3 138068940 missense probably benign 0.02
R6305:1110002E22Rik UTSW 3 138067980 missense probably damaging 1.00
R6457:1110002E22Rik UTSW 3 138066622 missense probably damaging 1.00
R6469:1110002E22Rik UTSW 3 138066975 missense probably damaging 0.97
R6499:1110002E22Rik UTSW 3 138068800 missense probably damaging 1.00
R6527:1110002E22Rik UTSW 3 138067527 missense probably damaging 0.99
R6580:1110002E22Rik UTSW 3 138066625 missense probably benign 0.00
R6693:1110002E22Rik UTSW 3 138069154 missense probably benign 0.00
R6751:1110002E22Rik UTSW 3 138066210 missense probably damaging 1.00
R6852:1110002E22Rik UTSW 3 138065169 nonsense probably null
R6920:1110002E22Rik UTSW 3 138068050 missense probably damaging 1.00
R7145:1110002E22Rik UTSW 3 138070059 missense probably damaging 1.00
R7238:1110002E22Rik UTSW 3 138069951 missense probably damaging 1.00
R7278:1110002E22Rik UTSW 3 138065476 missense probably benign
R7425:1110002E22Rik UTSW 3 138065695 missense probably benign 0.00
R7487:1110002E22Rik UTSW 3 138066868 missense probably damaging 1.00
R7557:1110002E22Rik UTSW 3 138068283 nonsense probably null
R7663:1110002E22Rik UTSW 3 138066126 missense probably damaging 0.98
R7743:1110002E22Rik UTSW 3 138068755 missense probably damaging 1.00
R7799:1110002E22Rik UTSW 3 138069601 missense probably benign 0.33
R8181:1110002E22Rik UTSW 3 138068395 missense probably damaging 0.99
R8264:1110002E22Rik UTSW 3 138067782 missense probably damaging 0.99
R8273:1110002E22Rik UTSW 3 138066450 missense probably benign
R8434:1110002E22Rik UTSW 3 138067260 missense probably damaging 0.97
R8530:1110002E22Rik UTSW 3 138068825 missense probably damaging 0.99
R8754:1110002E22Rik UTSW 3 138066037 missense probably benign
R8808:1110002E22Rik UTSW 3 138070113 missense probably benign 0.01
R8891:1110002E22Rik UTSW 3 138066759 nonsense probably null
R9026:1110002E22Rik UTSW 3 138065148 missense possibly damaging 0.53
R9177:1110002E22Rik UTSW 3 138069916 missense probably damaging 1.00
R9250:1110002E22Rik UTSW 3 138066628 missense probably damaging 1.00
R9291:1110002E22Rik UTSW 3 138066703 missense probably benign 0.02
R9293:1110002E22Rik UTSW 3 138066078 missense possibly damaging 0.93
R9307:1110002E22Rik UTSW 3 138065422 missense probably benign 0.04
R9439:1110002E22Rik UTSW 3 138066287 missense not run
X0003:1110002E22Rik UTSW 3 138069096 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGGTACCTACAGCCTTGG -3'
(R):5'- GGCCATTGTCTTCTGCACTG -3'

Sequencing Primer
(F):5'- CACGTGGGAACCTGTTT -3'
(R):5'- AGAAGTCGTTCTCACAAGCCTGG -3'
Posted On 2019-05-13