Mutagenetix > Incidental Mutation

Incidental Mutation 'R7001:Col24a1'

544530

Institutional Source

Beutler Lab

Gene Symbol

Col24a1

Ensembl Gene

ENSMUSG00000028197

Gene Name

collagen, type XXIV, alpha 1

Synonyms

5430404K19Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7001 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

145292472-145552011 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 145298866 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 35 (V35A)

Ref Sequence

ENSEMBL: ENSMUSP00000029848 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029848] [ENSMUST00000139001]

AlphaFold

Q30D77

Predicted Effect

probably benign
Transcript: ENSMUST00000029848
AA Change: V35A

PolyPhen 2 Score 0.285 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000029848
Gene: ENSMUSG00000028197
AA Change: V35A

Domain	Start	End	E-Value	Type
transmembrane domain	21	40	N/A	INTRINSIC
TSPN	41	230	2.7e-3	SMART
LamG	106	229	8.07e-2	SMART
Pfam:Collagen	506	565	9.6e-10	PFAM
Pfam:Collagen	561	623	3.4e-10	PFAM
Pfam:Collagen	604	678	2.3e-9	PFAM
low complexity region	682	724	N/A	INTRINSIC
Pfam:Collagen	772	837	1.3e-10	PFAM
Pfam:Collagen	865	938	6e-9	PFAM
Pfam:Collagen	967	1042	3.1e-8	PFAM
low complexity region	1056	1075	N/A	INTRINSIC
Pfam:Collagen	1107	1180	8e-9	PFAM
Pfam:Collagen	1159	1218	4.2e-10	PFAM
Pfam:Collagen	1218	1279	1.8e-10	PFAM
Pfam:Collagen	1270	1334	3.1e-9	PFAM
Pfam:Collagen	1378	1443	1.3e-9	PFAM
Pfam:Collagen	1439	1500	1.8e-9	PFAM
COLFI	1533	1733	9.34e-34	SMART

Predicted Effect

silent
Transcript: ENSMUST00000139001

Meta Mutation Damage Score

0.0634

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.8%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: This gene encodes the alpha-1 subunit of type XXIV collagen, one of the low abundance fibril-forming collagens found in cartilage. The encoded protein has structural features of invertebrate fibrillar collagens and is expressed predominantly in bone tissue. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	C	A	3: 138,065,511	Q154K	probably benign	Het
Aldh6a1	T	G	12: 84,441,888	T75P	probably damaging	Het
Ank2	T	A	3: 127,077,581	H98L	probably damaging	Het
Ankib1	A	G	5: 3,694,781	F800S	probably benign	Het
Arhgap10	A	T	8: 77,365,088	M434K	possibly damaging	Het
Cap1	A	T	4: 122,864,615	F257L	probably benign	Het
Cdt1	T	A	8: 122,572,510	H510Q	probably damaging	Het
Clca3b	A	C	3: 144,827,972	D547E	possibly damaging	Het
Cyp2j13	A	T	4: 96,056,875	N305K	probably damaging	Het
D3Ertd751e	T	A	3: 41,758,409		probably null	Het
D6Ertd527e	G	A	6: 87,111,212	G119D	unknown	Het
Ddc	T	C	11: 11,824,870		probably null	Het
Dnah12	A	T	14: 26,879,724	Y3713F	probably damaging	Het
Dock8	T	A	19: 25,099,677	S504T	probably benign	Het
Farp2	T	C	1: 93,620,184	F941L	possibly damaging	Het
Farp2	A	G	1: 93,620,230	N956S	possibly damaging	Het
Fbxo3	T	A	2: 104,051,224	H300Q	probably damaging	Het
Fcgrt	T	C	7: 45,102,042	T131A	probably benign	Het
Fndc7	G	A	3: 108,876,648	A215V	probably benign	Het
Frem1	T	C	4: 82,986,561	E890G	probably benign	Het
Fsip2	C	A	2: 82,986,925	P4334H	probably damaging	Het
Gcdh	C	A	8: 84,890,911	V227L	probably benign	Het
Gm8267	A	C	14: 44,722,928	M120R	possibly damaging	Het
Gpatch2l	G	A	12: 86,244,184	R47H	probably damaging	Het
Lasp1	T	G	11: 97,806,833	H26Q	probably damaging	Het
Lrrcc1	T	A	3: 14,540,095	I297N	probably damaging	Het
Map1b	A	T	13: 99,430,593	N1873K	unknown	Het
Map2	A	G	1: 66,415,487	I1179V	probably benign	Het
Mtss1	A	C	15: 58,948,334		probably benign	Het
Mtus2	A	G	5: 148,277,628	E28G	probably damaging	Het
Muc6	G	A	7: 141,637,407	T2386I	probably damaging	Het
Myo3a	G	T	2: 22,332,377	V362L	probably benign	Het
N6amt1	G	A	16: 87,354,292	V14M	probably benign	Het
Nav1	A	T	1: 135,454,611		probably null	Het
Nol6	A	G	4: 41,121,279	S326P	probably benign	Het
Olfr1084	A	T	2: 86,639,151	S186T	probably benign	Het
Olfr599	A	G	7: 103,338,221	S56G	possibly damaging	Het
Olr1	T	A	6: 129,488,111	E100V	probably damaging	Het
Otop3	T	C	11: 115,339,653	Y119H	probably damaging	Het
Prpmp5	C	T	6: 132,312,564	G99E	unknown	Het
Ryr2	A	T	13: 11,794,605	M778K	probably damaging	Het
Serpina3n	G	T	12: 104,408,925	M85I	probably benign	Het
Serpine2	A	G	1: 79,795,031	F390L	probably damaging	Het
Sf3b1	A	G	1: 55,001,046	V591A	probably damaging	Het
Sf3b1	A	G	1: 55,014,481		probably null	Het
Slc26a5	C	T	5: 21,811,336	V646I	probably damaging	Het
Slitrk3	T	A	3: 73,050,609	K277*	probably null	Het
Sv2c	A	G	13: 95,981,953	S463P	probably benign	Het
Tbc1d4	G	A	14: 101,458,749	T858M	probably benign	Het
Tbx18	T	A	9: 87,727,404	I193F	probably damaging	Het
Tm6sf2	A	C	8: 70,078,332	D245A	probably damaging	Het
Unc119	T	C	11: 78,348,554	Y234H	probably damaging	Het
Wrn	A	T	8: 33,352,129	S46T	probably benign	Het
Zfp729a	A	T	13: 67,620,349	I587K	probably benign	Het
Zfp872	C	A	9: 22,200,616	H464N	probably damaging	Het

Other mutations in Col24a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00841:Col24a1	APN	3	145362309	missense	probably damaging	1.00
IGL00931:Col24a1	APN	3	145461470	missense	probably benign	0.00
IGL01160:Col24a1	APN	3	145507713	missense	probably damaging	1.00
IGL01355:Col24a1	APN	3	145314876	missense	probably benign	0.07
IGL01409:Col24a1	APN	3	145538564	missense	probably benign	0.19
IGL01587:Col24a1	APN	3	145433355	splice site	probably null
IGL01666:Col24a1	APN	3	145344686	missense	possibly damaging	0.93
IGL01717:Col24a1	APN	3	145524263	splice site	probably benign
IGL01721:Col24a1	APN	3	145538567	missense	probably benign	0.26
IGL01939:Col24a1	APN	3	145315244	missense	probably damaging	1.00
IGL01988:Col24a1	APN	3	145524167	splice site	probably null
IGL02002:Col24a1	APN	3	145356944	missense	possibly damaging	0.81
IGL02172:Col24a1	APN	3	145314962	missense	probably benign	0.34
IGL02552:Col24a1	APN	3	145474207	missense	possibly damaging	0.88
IGL02559:Col24a1	APN	3	145314173	missense	probably benign
IGL02582:Col24a1	APN	3	145314486	missense	probably damaging	1.00
IGL02652:Col24a1	APN	3	145492301	nonsense	probably null
IGL02942:Col24a1	APN	3	145541665	missense	probably damaging	1.00
IGL03032:Col24a1	APN	3	145538703	critical splice donor site	probably null
IGL03108:Col24a1	APN	3	145323401	missense	probably damaging	1.00
IGL03310:Col24a1	APN	3	145313983	splice site	probably benign
IGL03405:Col24a1	APN	3	145315157	missense	possibly damaging	0.73
R0066:Col24a1	UTSW	3	145545144	missense	probably damaging	1.00
R0066:Col24a1	UTSW	3	145545144	missense	probably damaging	1.00
R0379:Col24a1	UTSW	3	145524142	missense	possibly damaging	0.94
R0502:Col24a1	UTSW	3	145545316	splice site	probably benign
R0556:Col24a1	UTSW	3	145314728	missense	possibly damaging	0.53
R0587:Col24a1	UTSW	3	145293145	missense	possibly damaging	0.50
R0617:Col24a1	UTSW	3	145314120	missense	probably damaging	1.00
R0831:Col24a1	UTSW	3	145328759	missense	probably damaging	1.00
R1455:Col24a1	UTSW	3	145460838	missense	probably damaging	1.00
R1664:Col24a1	UTSW	3	145389600	critical splice donor site	probably null
R1713:Col24a1	UTSW	3	145366869	nonsense	probably null
R1854:Col24a1	UTSW	3	145459140	missense	probably damaging	1.00
R1855:Col24a1	UTSW	3	145459140	missense	probably damaging	1.00
R1861:Col24a1	UTSW	3	145537267	critical splice donor site	probably null
R1969:Col24a1	UTSW	3	145314930	missense	probably benign	0.03
R2216:Col24a1	UTSW	3	145314981	missense	probably benign	0.34
R2290:Col24a1	UTSW	3	145513195	missense	probably damaging	1.00
R3702:Col24a1	UTSW	3	145337860	missense	probably benign	0.01
R3772:Col24a1	UTSW	3	145545286	missense	probably damaging	1.00
R4086:Col24a1	UTSW	3	145461437	missense	probably damaging	1.00
R4236:Col24a1	UTSW	3	145524282	nonsense	probably null
R4433:Col24a1	UTSW	3	145314383	missense	possibly damaging	0.95
R4688:Col24a1	UTSW	3	145314383	missense	probably benign	0.00
R4972:Col24a1	UTSW	3	145509684	missense	probably benign	0.42
R5157:Col24a1	UTSW	3	145345951	nonsense	probably null
R5216:Col24a1	UTSW	3	145315310	missense	possibly damaging	0.85
R5274:Col24a1	UTSW	3	145484678	missense	probably benign	0.03
R5334:Col24a1	UTSW	3	145461525	missense	possibly damaging	0.91
R5416:Col24a1	UTSW	3	145315025	nonsense	probably null
R5473:Col24a1	UTSW	3	145537261	missense	probably benign	0.41
R5538:Col24a1	UTSW	3	145293121	missense	probably damaging	0.99
R5561:Col24a1	UTSW	3	145298827	missense	probably benign	0.26
R5648:Col24a1	UTSW	3	145358566	missense	probably benign	0.00
R5920:Col24a1	UTSW	3	145428230	missense	probably damaging	1.00
R6111:Col24a1	UTSW	3	145314054	missense	probably damaging	0.99
R6151:Col24a1	UTSW	3	145314054	missense	probably damaging	0.99
R6701:Col24a1	UTSW	3	145314380	missense	probably benign	0.00
R6728:Col24a1	UTSW	3	145315196	missense	probably benign
R6734:Col24a1	UTSW	3	145508674	missense	probably benign	0.06
R6861:Col24a1	UTSW	3	145460834	missense	probably damaging	1.00
R6982:Col24a1	UTSW	3	145315046	nonsense	probably null
R7148:Col24a1	UTSW	3	145315299	missense	probably damaging	1.00
R7293:Col24a1	UTSW	3	145486304	nonsense	probably null
R7315:Col24a1	UTSW	3	145431870	missense	possibly damaging	0.82
R7358:Col24a1	UTSW	3	145293165	critical splice donor site	probably null
R7371:Col24a1	UTSW	3	145343698	missense	probably benign	0.06
R7383:Col24a1	UTSW	3	145298838	missense	probably benign
R7605:Col24a1	UTSW	3	145538687	missense	possibly damaging	0.67
R7650:Col24a1	UTSW	3	145314453	missense	probably benign	0.00
R7679:Col24a1	UTSW	3	145399355	missense	possibly damaging	0.81
R7701:Col24a1	UTSW	3	145315011	missense	probably benign
R7701:Col24a1	UTSW	3	145366901	splice site	probably null
R7805:Col24a1	UTSW	3	145314140	missense	probably benign	0.02
R7913:Col24a1	UTSW	3	145431866	nonsense	probably null
R7921:Col24a1	UTSW	3	145474238	missense	probably damaging	1.00
R8056:Col24a1	UTSW	3	145314164	missense	possibly damaging	0.73
R8240:Col24a1	UTSW	3	145507702	missense	probably benign	0.31
R8294:Col24a1	UTSW	3	145481089	missense	probably null	1.00
R8305:Col24a1	UTSW	3	145474182	missense	probably benign	0.00
R8430:Col24a1	UTSW	3	145315299	missense	probably damaging	1.00
R8708:Col24a1	UTSW	3	145545265	missense	probably damaging	0.99
R8880:Col24a1	UTSW	3	145314037	missense	probably null
R9056:Col24a1	UTSW	3	145315248	missense	probably damaging	0.96
R9461:Col24a1	UTSW	3	145481124	nonsense	probably null
R9612:Col24a1	UTSW	3	145545205	missense	probably benign	0.32
R9777:Col24a1	UTSW	3	145315342	nonsense	probably null
Z1176:Col24a1	UTSW	3	145342498	missense	probably damaging	1.00
Z1177:Col24a1	UTSW	3	145342499	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTGAACACGGCTCATTCTAAAG -3'
(R):5'- ACTGTTGCAAGCAGAAATGC -3'

Sequencing Primer
(F):5'- TCATTCTAAAGCGGTGGACC -3'
(R):5'- TGTGCAGCATCCGCAAATG -3'

Posted On

2019-05-13