Incidental Mutation 'R7001:Cap1'
ID544534
Institutional Source Beutler Lab
Gene Symbol Cap1
Ensembl Gene ENSMUSG00000028656
Gene NameCAP, adenylate cyclase-associated protein 1 (yeast)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.729) question?
Stock #R7001 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location122859047-122886056 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 122864615 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 257 (F257L)
Ref Sequence ENSEMBL: ENSMUSP00000101864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069533] [ENSMUST00000106255] [ENSMUST00000106257] [ENSMUST00000128485]
Predicted Effect probably benign
Transcript: ENSMUST00000069533
AA Change: F257L

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000068260
Gene: ENSMUSG00000028656
AA Change: F257L

DomainStartEndE-ValueType
Pfam:CAP_N 4 304 1e-129 PFAM
CARP 355 392 2.09e-9 SMART
CARP 393 430 1.18e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106255
AA Change: F257L

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000101862
Gene: ENSMUSG00000028656
AA Change: F257L

DomainStartEndE-ValueType
Pfam:CAP_N 5 294 4.2e-116 PFAM
CARP 355 392 2.09e-9 SMART
CARP 393 430 1.18e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106257
AA Change: F257L

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000101864
Gene: ENSMUSG00000028656
AA Change: F257L

DomainStartEndE-ValueType
Pfam:CAP_N 4 304 1e-129 PFAM
CARP 355 392 2.09e-9 SMART
CARP 393 430 1.18e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128485
SMART Domains Protein: ENSMUSP00000114847
Gene: ENSMUSG00000028656

DomainStartEndE-ValueType
Pfam:CAP_N 4 164 2.3e-65 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: The product of this gene plays a role in regulating actin dynamics by binding actin monomers and promoting the turnover of actin filaments. Reduced expression of this gene causes a reduction in actin filament turnover rates, causing multiple defects, including an increase in cell size, stress-fiber alterations, and defects in endocytosis and cell motility. A pseudogene of this gene is found on chromosome 14. Alternative splicing results in multiple transcript variants, but does not affect the protein. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C A 3: 138,065,511 Q154K probably benign Het
Aldh6a1 T G 12: 84,441,888 T75P probably damaging Het
Ank2 T A 3: 127,077,581 H98L probably damaging Het
Ankib1 A G 5: 3,694,781 F800S probably benign Het
Arhgap10 A T 8: 77,365,088 M434K possibly damaging Het
Cdt1 T A 8: 122,572,510 H510Q probably damaging Het
Clca3b A C 3: 144,827,972 D547E possibly damaging Het
Col24a1 T C 3: 145,298,866 V35A probably benign Het
Cyp2j13 A T 4: 96,056,875 N305K probably damaging Het
D3Ertd751e T A 3: 41,758,409 probably null Het
D6Ertd527e G A 6: 87,111,212 G119D unknown Het
Ddc T C 11: 11,824,870 probably null Het
Dnah12 A T 14: 26,879,724 Y3713F probably damaging Het
Dock8 T A 19: 25,099,677 S504T probably benign Het
Farp2 T C 1: 93,620,184 F941L possibly damaging Het
Farp2 A G 1: 93,620,230 N956S possibly damaging Het
Fbxo3 T A 2: 104,051,224 H300Q probably damaging Het
Fcgrt T C 7: 45,102,042 T131A probably benign Het
Fndc7 G A 3: 108,876,648 A215V probably benign Het
Frem1 T C 4: 82,986,561 E890G probably benign Het
Fsip2 C A 2: 82,986,925 P4334H probably damaging Het
Gcdh C A 8: 84,890,911 V227L probably benign Het
Gm8267 A C 14: 44,722,928 M120R possibly damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Lasp1 T G 11: 97,806,833 H26Q probably damaging Het
Lrrcc1 T A 3: 14,540,095 I297N probably damaging Het
Map1b A T 13: 99,430,593 N1873K unknown Het
Map2 A G 1: 66,415,487 I1179V probably benign Het
Mtss1 A C 15: 58,948,334 probably benign Het
Mtus2 A G 5: 148,277,628 E28G probably damaging Het
Muc6 G A 7: 141,637,407 T2386I probably damaging Het
Myo3a G T 2: 22,332,377 V362L probably benign Het
N6amt1 G A 16: 87,354,292 V14M probably benign Het
Nav1 A T 1: 135,454,611 probably null Het
Nol6 A G 4: 41,121,279 S326P probably benign Het
Olfr1084 A T 2: 86,639,151 S186T probably benign Het
Olfr599 A G 7: 103,338,221 S56G possibly damaging Het
Olr1 T A 6: 129,488,111 E100V probably damaging Het
Otop3 T C 11: 115,339,653 Y119H probably damaging Het
Prpmp5 C T 6: 132,312,564 G99E unknown Het
Ryr2 A T 13: 11,794,605 M778K probably damaging Het
Serpina3n G T 12: 104,408,925 M85I probably benign Het
Serpine2 A G 1: 79,795,031 F390L probably damaging Het
Sf3b1 A G 1: 55,001,046 V591A probably damaging Het
Sf3b1 A G 1: 55,014,481 probably null Het
Slc26a5 C T 5: 21,811,336 V646I probably damaging Het
Slitrk3 T A 3: 73,050,609 K277* probably null Het
Sv2c A G 13: 95,981,953 S463P probably benign Het
Tbc1d4 G A 14: 101,458,749 T858M probably benign Het
Tbx18 T A 9: 87,727,404 I193F probably damaging Het
Tm6sf2 A C 8: 70,078,332 D245A probably damaging Het
Unc119 T C 11: 78,348,554 Y234H probably damaging Het
Wrn A T 8: 33,352,129 S46T probably benign Het
Zfp729a A T 13: 67,620,349 I587K probably benign Het
Zfp872 C A 9: 22,200,616 H464N probably damaging Het
Other mutations in Cap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01449:Cap1 APN 4 122860187 missense probably damaging 0.99
IGL02163:Cap1 APN 4 122862416 missense probably benign 0.00
R0115:Cap1 UTSW 4 122863075 missense possibly damaging 0.94
R0119:Cap1 UTSW 4 122867699 missense probably damaging 1.00
R0481:Cap1 UTSW 4 122863075 missense possibly damaging 0.94
R0534:Cap1 UTSW 4 122862719 missense probably benign 0.07
R0602:Cap1 UTSW 4 122872409 missense probably damaging 1.00
R0846:Cap1 UTSW 4 122862899 critical splice donor site probably null
R1311:Cap1 UTSW 4 122865214 missense possibly damaging 0.89
R2027:Cap1 UTSW 4 122862893 unclassified probably benign
R2446:Cap1 UTSW 4 122864608 missense probably benign 0.22
R2860:Cap1 UTSW 4 122864725 missense probably benign 0.01
R2861:Cap1 UTSW 4 122864725 missense probably benign 0.01
R2862:Cap1 UTSW 4 122864725 missense probably benign 0.01
R3690:Cap1 UTSW 4 122864626 missense probably damaging 0.98
R3691:Cap1 UTSW 4 122864626 missense probably damaging 0.98
R4089:Cap1 UTSW 4 122862409 missense probably benign 0.05
R4362:Cap1 UTSW 4 122862987 missense probably benign 0.00
R5511:Cap1 UTSW 4 122862790 unclassified probably benign
R6252:Cap1 UTSW 4 122872400 missense probably benign 0.37
R7709:Cap1 UTSW 4 122862674 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTAAGTTTGATGTCCCTTTAGAC -3'
(R):5'- GATAGGAGACTTAAATCACCAAGGC -3'

Sequencing Primer
(F):5'- CTTTAGACACCCCCAAATGAATGTTG -3'
(R):5'- GATGGTCCAGCATTTAAGAGCTC -3'
Posted On2019-05-13