Incidental Mutation 'R7001:Prpmp5'
ID544540
Institutional Source Beutler Lab
Gene Symbol Prpmp5
Ensembl Gene ENSMUSG00000107874
Gene Nameproline-rich protein MP5
SynonymsMP5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #R7001 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location132311590-132314757 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 132312564 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 99 (G99E)
Ref Sequence ENSEMBL: ENSMUSP00000047347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048686]
Predicted Effect unknown
Transcript: ENSMUST00000048686
AA Change: G99E
SMART Domains Protein: ENSMUSP00000047347
Gene: ENSMUSG00000107874
AA Change: G99E

DomainStartEndE-ValueType
Pfam:Pro-rich 1 136 2.2e-36 PFAM
Pfam:Pro-rich 84 169 6.1e-17 PFAM
Pfam:Pro-rich 131 182 2.5e-10 PFAM
Pfam:Pro-rich 171 228 4.7e-10 PFAM
Pfam:Pro-rich 222 290 1.1e-11 PFAM
Meta Mutation Damage Score 0.0991 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C A 3: 138,065,511 Q154K probably benign Het
Aldh6a1 T G 12: 84,441,888 T75P probably damaging Het
Ank2 T A 3: 127,077,581 H98L probably damaging Het
Ankib1 A G 5: 3,694,781 F800S probably benign Het
Arhgap10 A T 8: 77,365,088 M434K possibly damaging Het
Cap1 A T 4: 122,864,615 F257L probably benign Het
Cdt1 T A 8: 122,572,510 H510Q probably damaging Het
Clca3b A C 3: 144,827,972 D547E possibly damaging Het
Col24a1 T C 3: 145,298,866 V35A probably benign Het
Cyp2j13 A T 4: 96,056,875 N305K probably damaging Het
D3Ertd751e T A 3: 41,758,409 probably null Het
D6Ertd527e G A 6: 87,111,212 G119D unknown Het
Ddc T C 11: 11,824,870 probably null Het
Dnah12 A T 14: 26,879,724 Y3713F probably damaging Het
Dock8 T A 19: 25,099,677 S504T probably benign Het
Farp2 T C 1: 93,620,184 F941L possibly damaging Het
Farp2 A G 1: 93,620,230 N956S possibly damaging Het
Fbxo3 T A 2: 104,051,224 H300Q probably damaging Het
Fcgrt T C 7: 45,102,042 T131A probably benign Het
Fndc7 G A 3: 108,876,648 A215V probably benign Het
Frem1 T C 4: 82,986,561 E890G probably benign Het
Fsip2 C A 2: 82,986,925 P4334H probably damaging Het
Gcdh C A 8: 84,890,911 V227L probably benign Het
Gm8267 A C 14: 44,722,928 M120R possibly damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Lasp1 T G 11: 97,806,833 H26Q probably damaging Het
Lrrcc1 T A 3: 14,540,095 I297N probably damaging Het
Map1b A T 13: 99,430,593 N1873K unknown Het
Map2 A G 1: 66,415,487 I1179V probably benign Het
Mtss1 A C 15: 58,948,334 probably benign Het
Mtus2 A G 5: 148,277,628 E28G probably damaging Het
Muc6 G A 7: 141,637,407 T2386I probably damaging Het
Myo3a G T 2: 22,332,377 V362L probably benign Het
N6amt1 G A 16: 87,354,292 V14M probably benign Het
Nav1 A T 1: 135,454,611 probably null Het
Nol6 A G 4: 41,121,279 S326P probably benign Het
Olfr1084 A T 2: 86,639,151 S186T probably benign Het
Olfr599 A G 7: 103,338,221 S56G possibly damaging Het
Olr1 T A 6: 129,488,111 E100V probably damaging Het
Otop3 T C 11: 115,339,653 Y119H probably damaging Het
Ryr2 A T 13: 11,794,605 M778K probably damaging Het
Serpina3n G T 12: 104,408,925 M85I probably benign Het
Serpine2 A G 1: 79,795,031 F390L probably damaging Het
Sf3b1 A G 1: 55,001,046 V591A probably damaging Het
Sf3b1 A G 1: 55,014,481 probably null Het
Slc26a5 C T 5: 21,811,336 V646I probably damaging Het
Slitrk3 T A 3: 73,050,609 K277* probably null Het
Sv2c A G 13: 95,981,953 S463P probably benign Het
Tbc1d4 G A 14: 101,458,749 T858M probably benign Het
Tbx18 T A 9: 87,727,404 I193F probably damaging Het
Tm6sf2 A C 8: 70,078,332 D245A probably damaging Het
Unc119 T C 11: 78,348,554 Y234H probably damaging Het
Wrn A T 8: 33,352,129 S46T probably benign Het
Zfp729a A T 13: 67,620,349 I587K probably benign Het
Zfp872 C A 9: 22,200,616 H464N probably damaging Het
Other mutations in Prpmp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01392:Prpmp5 APN 6 132312420 missense unknown
IGL02259:Prpmp5 APN 6 132312674 missense unknown
IGL02434:Prpmp5 APN 6 132312376 missense unknown
IGL03238:Prpmp5 APN 6 132312345 missense unknown
R0971:Prpmp5 UTSW 6 132313655 missense unknown
R1900:Prpmp5 UTSW 6 132314698 missense unknown
R3800:Prpmp5 UTSW 6 132312694 missense unknown
R3951:Prpmp5 UTSW 6 132312694 missense unknown
R3952:Prpmp5 UTSW 6 132312694 missense unknown
R3981:Prpmp5 UTSW 6 132312694 missense unknown
R4083:Prpmp5 UTSW 6 132312694 missense unknown
R4348:Prpmp5 UTSW 6 132313661 missense unknown
R4351:Prpmp5 UTSW 6 132313661 missense unknown
R4352:Prpmp5 UTSW 6 132313661 missense unknown
R4353:Prpmp5 UTSW 6 132313661 missense unknown
R6190:Prpmp5 UTSW 6 132312729 missense unknown
Predicted Primers PCR Primer
(F):5'- TTCATGGTTCCCAGGCCTAAG -3'
(R):5'- TTTACTTGAATAGAGATGGGAGAGC -3'

Sequencing Primer
(F):5'- TTCCCAGGCCTAAGGGGTC -3'
(R):5'- AGCCAAGGGTATGGTCATCATTTTC -3'
Posted On2019-05-13