Mutagenetix > Incidental Mutation

Incidental Mutation 'R7001:Muc6'

544543

Institutional Source

Beutler Lab

Gene Symbol

Muc6

Ensembl Gene

ENSMUSG00000048191

Gene Name

mucin 6, gastric

Synonyms

MMRRC Submission

045106-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.097) question?

Stock #

R7001 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

141213373-141241641 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 141217320 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 2386 (T2386I)

Ref Sequence

ENSEMBL: ENSMUSP00000049941 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003038] [ENSMUST00000062451] [ENSMUST00000189314] [ENSMUST00000190907]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000003038

SMART Domains

Protein: ENSMUSP00000003038
Gene: ENSMUSG00000002957

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	29	590	1.7e-147	PFAM
low complexity region	646	659	N/A	INTRINSIC
low complexity region	661	684	N/A	INTRINSIC
Alpha_adaptinC2	706	819	1.45e-26	SMART
Pfam:Alpha_adaptin_C	825	933	2.8e-47	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000062451
AA Change: T2386I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000049941
Gene: ENSMUSG00000048191
AA Change: T2386I

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
VWD	29	234	2.49e-14	SMART
C8	267	340	5.46e-3	SMART
Pfam:TIL	344	399	5.6e-14	PFAM
VWC	401	469	2.57e-7	SMART
VWD	428	591	4.81e-30	SMART
C8	627	703	8.84e-21	SMART
SCOP:d1coua_	706	769	7e-9	SMART
Pfam:TIL	806	869	1.9e-9	PFAM
VWC	871	941	8.52e-3	SMART
VWD	898	1060	1.59e-30	SMART
C8	1096	1170	5.52e-31	SMART
Blast:CT	1184	1236	2e-19	BLAST
low complexity region	1240	1269	N/A	INTRINSIC
low complexity region	1275	1293	N/A	INTRINSIC
low complexity region	1313	1337	N/A	INTRINSIC
low complexity region	1345	1374	N/A	INTRINSIC
internal_repeat_3	1375	1560	6.78e-17	PROSPERO
internal_repeat_2	1426	1751	8.94e-34	PROSPERO
low complexity region	1761	1780	N/A	INTRINSIC
low complexity region	1867	1887	N/A	INTRINSIC
low complexity region	1896	1910	N/A	INTRINSIC
low complexity region	1912	1946	N/A	INTRINSIC
low complexity region	1990	2004	N/A	INTRINSIC
low complexity region	2010	2020	N/A	INTRINSIC
internal_repeat_2	2036	2430	8.94e-34	PROSPERO
internal_repeat_3	2329	2516	6.78e-17	PROSPERO
low complexity region	2519	2536	N/A	INTRINSIC
low complexity region	2564	2587	N/A	INTRINSIC
low complexity region	2605	2630	N/A	INTRINSIC
low complexity region	2642	2677	N/A	INTRINSIC
low complexity region	2729	2762	N/A	INTRINSIC
Blast:CT	2765	2852	1e-44	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000189314

SMART Domains

Protein: ENSMUSP00000140388
Gene: ENSMUSG00000048191

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
VWD	29	193	2.64e-27	SMART
C8	226	299	5.46e-3	SMART
Pfam:TIL	303	358	1.4e-13	PFAM
VWC	360	428	2.57e-7	SMART
VWD	387	550	4.81e-30	SMART
C8	586	662	8.84e-21	SMART
internal_repeat_2	665	754	5.76e-7	PROSPERO
Pfam:TIL	765	828	6.4e-9	PFAM
VWC	830	900	8.52e-3	SMART
VWD	857	1019	1.59e-30	SMART
C8	1055	1129	5.52e-31	SMART
low complexity region	1199	1228	N/A	INTRINSIC
low complexity region	1234	1252	N/A	INTRINSIC
low complexity region	1272	1296	N/A	INTRINSIC
low complexity region	1304	1333	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000190907
AA Change: T2451I

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000140483
Gene: ENSMUSG00000048191
AA Change: T2451I

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
VWD	29	234	1.2e-16	SMART
C8	267	340	4.2e-7	SMART
Pfam:TIL	344	399	7.2e-11	PFAM
VWC_def	401	469	1.2e-9	SMART
VWD	428	591	2.4e-32	SMART
C8	627	703	6.7e-25	SMART
SCOP:d1coua_	706	769	5e-9	SMART
Pfam:TIL	806	869	3.3e-6	PFAM
VWC_def	871	941	4.1e-5	SMART
VWD	898	1060	7.7e-33	SMART
C8	1096	1170	4.2e-35	SMART
Blast:CT	1184	1236	2e-19	BLAST
low complexity region	1240	1269	N/A	INTRINSIC
low complexity region	1275	1293	N/A	INTRINSIC
low complexity region	1313	1337	N/A	INTRINSIC
low complexity region	1345	1374	N/A	INTRINSIC
low complexity region	1406	1419	N/A	INTRINSIC
internal_repeat_1	1426	1822	3.44e-48	PROSPERO
low complexity region	1826	1845	N/A	INTRINSIC
low complexity region	1932	1952	N/A	INTRINSIC
low complexity region	1961	1975	N/A	INTRINSIC
low complexity region	1977	2011	N/A	INTRINSIC
low complexity region	2055	2069	N/A	INTRINSIC
low complexity region	2075	2085	N/A	INTRINSIC
internal_repeat_1	2101	2501	3.44e-48	PROSPERO
low complexity region	2504	2524	N/A	INTRINSIC
low complexity region	2584	2601	N/A	INTRINSIC
low complexity region	2629	2652	N/A	INTRINSIC
low complexity region	2670	2695	N/A	INTRINSIC
low complexity region	2707	2742	N/A	INTRINSIC
low complexity region	2794	2827	N/A	INTRINSIC
Blast:CT	2830	2917	1e-44	BLAST

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.8%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. [provided by RefSeq, Dec 2016]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	C	A	3: 137,771,272 (GRCm39)	Q154K	probably benign	Het
Aldh6a1	T	G	12: 84,488,662 (GRCm39)	T75P	probably damaging	Het
Ank2	T	A	3: 126,871,230 (GRCm39)	H98L	probably damaging	Het
Ankib1	A	G	5: 3,744,781 (GRCm39)	F800S	probably benign	Het
Arhgap10	A	T	8: 78,091,717 (GRCm39)	M434K	possibly damaging	Het
Cap1	A	T	4: 122,758,408 (GRCm39)	F257L	probably benign	Het
Cdt1	T	A	8: 123,299,249 (GRCm39)	H510Q	probably damaging	Het
Clca3b	A	C	3: 144,533,733 (GRCm39)	D547E	possibly damaging	Het
Col24a1	T	C	3: 145,004,627 (GRCm39)	V35A	probably benign	Het
Cyp2j13	A	T	4: 95,945,112 (GRCm39)	N305K	probably damaging	Het
D3Ertd751e	T	A	3: 41,712,844 (GRCm39)		probably null	Het
D6Ertd527e	G	A	6: 87,088,194 (GRCm39)	G119D	unknown	Het
Ddc	T	C	11: 11,774,870 (GRCm39)		probably null	Het
Dnah12	A	T	14: 26,601,681 (GRCm39)	Y3713F	probably damaging	Het
Dock8	T	A	19: 25,077,041 (GRCm39)	S504T	probably benign	Het
Farp2	T	C	1: 93,547,906 (GRCm39)	F941L	possibly damaging	Het
Farp2	A	G	1: 93,547,952 (GRCm39)	N956S	possibly damaging	Het
Fbxo3	T	A	2: 103,881,569 (GRCm39)	H300Q	probably damaging	Het
Fcgrt	T	C	7: 44,751,466 (GRCm39)	T131A	probably benign	Het
Fndc7	G	A	3: 108,783,964 (GRCm39)	A215V	probably benign	Het
Frem1	T	C	4: 82,904,798 (GRCm39)	E890G	probably benign	Het
Fsip2	C	A	2: 82,817,269 (GRCm39)	P4334H	probably damaging	Het
Gcdh	C	A	8: 85,617,540 (GRCm39)	V227L	probably benign	Het
Gm8267	A	C	14: 44,960,385 (GRCm39)	M120R	possibly damaging	Het
Gpatch2l	G	A	12: 86,290,958 (GRCm39)	R47H	probably damaging	Het
Lasp1	T	G	11: 97,697,659 (GRCm39)	H26Q	probably damaging	Het
Lrrcc1	T	A	3: 14,605,155 (GRCm39)	I297N	probably damaging	Het
Map1b	A	T	13: 99,567,101 (GRCm39)	N1873K	unknown	Het
Map2	A	G	1: 66,454,646 (GRCm39)	I1179V	probably benign	Het
Mtss1	A	C	15: 58,820,183 (GRCm39)		probably benign	Het
Mtus2	A	G	5: 148,214,438 (GRCm39)	E28G	probably damaging	Het
Myo3a	G	T	2: 22,337,188 (GRCm39)	V362L	probably benign	Het
N6amt1	G	A	16: 87,151,180 (GRCm39)	V14M	probably benign	Het
Nav1	A	T	1: 135,382,349 (GRCm39)		probably null	Het
Nol6	A	G	4: 41,121,279 (GRCm39)	S326P	probably benign	Het
Olr1	T	A	6: 129,465,074 (GRCm39)	E100V	probably damaging	Het
Or52ab4	A	G	7: 102,987,428 (GRCm39)	S56G	possibly damaging	Het
Or8k37	A	T	2: 86,469,495 (GRCm39)	S186T	probably benign	Het
Otop3	T	C	11: 115,230,479 (GRCm39)	Y119H	probably damaging	Het
Prb1b	C	T	6: 132,289,527 (GRCm39)	G99E	unknown	Het
Ryr2	A	T	13: 11,809,491 (GRCm39)	M778K	probably damaging	Het
Serpina3n	G	T	12: 104,375,184 (GRCm39)	M85I	probably benign	Het
Serpine2	A	G	1: 79,772,748 (GRCm39)	F390L	probably damaging	Het
Sf3b1	A	G	1: 55,040,205 (GRCm39)	V591A	probably damaging	Het
Sf3b1	A	G	1: 55,053,640 (GRCm39)		probably null	Het
Slc26a5	C	T	5: 22,016,334 (GRCm39)	V646I	probably damaging	Het
Slitrk3	T	A	3: 72,957,942 (GRCm39)	K277*	probably null	Het
Sv2c	A	G	13: 96,118,461 (GRCm39)	S463P	probably benign	Het
Tbc1d4	G	A	14: 101,696,185 (GRCm39)	T858M	probably benign	Het
Tbx18	T	A	9: 87,609,457 (GRCm39)	I193F	probably damaging	Het
Tm6sf2	A	C	8: 70,530,982 (GRCm39)	D245A	probably damaging	Het
Unc119	T	C	11: 78,239,380 (GRCm39)	Y234H	probably damaging	Het
Wrn	A	T	8: 33,842,157 (GRCm39)	S46T	probably benign	Het
Zfp729a	A	T	13: 67,768,468 (GRCm39)	I587K	probably benign	Het
Zfp872	C	A	9: 22,111,912 (GRCm39)	H464N	probably damaging	Het

Other mutations in Muc6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Muc6	APN	7	141,218,497 (GRCm39)	missense	probably benign	0.06
IGL00466:Muc6	APN	7	141,232,169 (GRCm39)	missense	possibly damaging	0.94
IGL00990:Muc6	APN	7	141,638,890 (GRCm38)	missense	possibly damaging	0.85
IGL01013:Muc6	APN	7	141,234,333 (GRCm39)	nonsense	probably null
IGL01021:Muc6	APN	7	141,217,075 (GRCm39)	missense	possibly damaging	0.53
IGL01061:Muc6	APN	7	141,234,720 (GRCm39)	missense	probably damaging	1.00
IGL01294:Muc6	APN	7	141,232,926 (GRCm39)	missense	probably damaging	1.00
IGL01449:Muc6	APN	7	141,218,527 (GRCm39)	missense	possibly damaging	0.92
IGL01474:Muc6	APN	7	141,237,572 (GRCm39)	missense	probably damaging	1.00
IGL01539:Muc6	APN	7	141,236,306 (GRCm39)	missense	probably benign	0.07
IGL01541:Muc6	APN	7	141,236,069 (GRCm39)	nonsense	probably null
IGL01810:Muc6	APN	7	141,237,327 (GRCm39)	missense	probably damaging	0.97
IGL01941:Muc6	APN	7	141,218,497 (GRCm39)	missense	probably benign	0.06
IGL01954:Muc6	APN	7	141,218,497 (GRCm39)	missense	probably benign	0.06
IGL02096:Muc6	APN	7	141,226,117 (GRCm39)	intron	probably benign
IGL02192:Muc6	APN	7	141,217,717 (GRCm39)	missense	possibly damaging	0.91
IGL02217:Muc6	APN	7	141,235,889 (GRCm39)	missense	probably damaging	1.00
IGL02234:Muc6	APN	7	141,226,842 (GRCm39)	missense	probably benign	0.09
IGL02302:Muc6	APN	7	141,227,763 (GRCm39)	missense	possibly damaging	0.53
IGL02331:Muc6	APN	7	141,226,726 (GRCm39)	missense	possibly damaging	0.53
IGL02531:Muc6	APN	7	141,216,853 (GRCm39)	missense	possibly damaging	0.53
IGL02639:Muc6	APN	7	141,235,843 (GRCm39)	splice site	probably benign
IGL02851:Muc6	APN	7	141,234,627 (GRCm39)	missense	probably damaging	1.00
IGL03026:Muc6	APN	7	141,226,414 (GRCm39)	intron	probably benign
IGL03070:Muc6	APN	7	141,230,834 (GRCm39)	splice site	probably benign
IGL03108:Muc6	APN	7	141,217,402 (GRCm39)	missense	possibly damaging	0.93
IGL03350:Muc6	APN	7	141,238,324 (GRCm39)	missense	probably damaging	1.00
IGL03366:Muc6	APN	7	141,234,349 (GRCm39)	missense	probably damaging	1.00
anticipation	UTSW	7	141,214,363 (GRCm39)	frame shift	probably null
F5770:Muc6	UTSW	7	141,233,880 (GRCm39)	missense	probably benign	0.11
IGL03147:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R0001:Muc6	UTSW	7	141,227,841 (GRCm39)	missense	possibly damaging	0.53
R0005:Muc6	UTSW	7	141,218,685 (GRCm39)	missense	possibly damaging	0.72
R0147:Muc6	UTSW	7	141,238,255 (GRCm39)	missense	probably damaging	1.00
R0153:Muc6	UTSW	7	141,214,029 (GRCm39)	missense	possibly damaging	0.68
R0227:Muc6	UTSW	7	141,223,981 (GRCm39)	intron	probably benign
R0234:Muc6	UTSW	7	141,235,939 (GRCm39)	missense	possibly damaging	0.95
R0234:Muc6	UTSW	7	141,235,939 (GRCm39)	missense	possibly damaging	0.95
R0304:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R0379:Muc6	UTSW	7	141,216,868 (GRCm39)	missense	possibly damaging	0.53
R0385:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R0423:Muc6	UTSW	7	141,238,548 (GRCm39)	missense	probably benign	0.01
R0499:Muc6	UTSW	7	141,226,735 (GRCm39)	missense	probably benign
R0503:Muc6	UTSW	7	141,218,685 (GRCm39)	missense	possibly damaging	0.72
R0757:Muc6	UTSW	7	141,218,497 (GRCm39)	missense	probably benign	0.06
R0792:Muc6	UTSW	7	141,223,981 (GRCm39)	intron	probably benign
R0880:Muc6	UTSW	7	141,217,270 (GRCm39)	missense	possibly damaging	0.91
R1136:Muc6	UTSW	7	141,218,685 (GRCm39)	missense	possibly damaging	0.72
R1170:Muc6	UTSW	7	141,230,500 (GRCm39)	missense	probably damaging	0.99
R1174:Muc6	UTSW	7	141,234,368 (GRCm39)	missense	probably damaging	1.00
R1175:Muc6	UTSW	7	141,234,368 (GRCm39)	missense	probably damaging	1.00
R1189:Muc6	UTSW	7	141,232,122 (GRCm39)	missense	probably damaging	1.00
R1259:Muc6	UTSW	7	141,226,464 (GRCm39)	intron	probably benign
R1293:Muc6	UTSW	7	141,238,255 (GRCm39)	missense	probably damaging	1.00
R1295:Muc6	UTSW	7	141,238,144 (GRCm39)	missense	probably benign	0.04
R1296:Muc6	UTSW	7	141,238,144 (GRCm39)	missense	probably benign	0.04
R1471:Muc6	UTSW	7	141,234,176 (GRCm39)	missense	possibly damaging	0.61
R1472:Muc6	UTSW	7	141,238,144 (GRCm39)	missense	probably benign	0.04
R1548:Muc6	UTSW	7	141,218,685 (GRCm39)	missense	possibly damaging	0.72
R1548:Muc6	UTSW	7	141,238,368 (GRCm39)	splice site	probably benign
R1576:Muc6	UTSW	7	141,214,437 (GRCm39)	missense	possibly damaging	0.92
R1689:Muc6	UTSW	7	141,234,265 (GRCm39)	missense	probably damaging	1.00
R1702:Muc6	UTSW	7	141,236,752 (GRCm39)	missense	probably damaging	1.00
R1792:Muc6	UTSW	7	141,214,371 (GRCm39)	missense	probably benign	0.41
R1924:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R1938:Muc6	UTSW	7	141,217,011 (GRCm39)	missense	probably damaging	0.99
R1964:Muc6	UTSW	7	141,226,330 (GRCm39)	intron	probably benign
R1964:Muc6	UTSW	7	141,226,329 (GRCm39)	nonsense	probably null
R1975:Muc6	UTSW	7	141,234,368 (GRCm39)	missense	probably damaging	1.00
R2031:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R2104:Muc6	UTSW	7	141,213,991 (GRCm39)	missense	probably benign	0.23
R2201:Muc6	UTSW	7	141,236,075 (GRCm39)	missense	probably damaging	1.00
R2218:Muc6	UTSW	7	141,233,227 (GRCm39)	missense	probably benign	0.41
R2245:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R2261:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R2271:Muc6	UTSW	7	141,217,423 (GRCm39)	missense	possibly damaging	0.53
R2272:Muc6	UTSW	7	141,217,423 (GRCm39)	missense	possibly damaging	0.53
R2284:Muc6	UTSW	7	141,217,837 (GRCm39)	missense	possibly damaging	0.53
R2310:Muc6	UTSW	7	141,217,444 (GRCm39)	missense	possibly damaging	0.53
R2566:Muc6	UTSW	7	141,226,651 (GRCm39)	missense	possibly damaging	0.73
R2975:Muc6	UTSW	7	141,216,951 (GRCm39)	missense	possibly damaging	0.86
R3406:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R3423:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R3548:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R3693:Muc6	UTSW	7	141,234,946 (GRCm39)	splice site	probably benign
R3872:Muc6	UTSW	7	141,226,867 (GRCm39)	missense	probably benign
R4029:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R4084:Muc6	UTSW	7	141,234,920 (GRCm39)	missense	probably damaging	1.00
R4126:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R4410:Muc6	UTSW	7	141,217,576 (GRCm39)	missense	possibly damaging	0.91
R4508:Muc6	UTSW	7	141,226,356 (GRCm39)	intron	probably benign
R4509:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R4518:Muc6	UTSW	7	141,230,489 (GRCm39)	missense	probably benign	0.03
R4594:Muc6	UTSW	7	141,218,685 (GRCm39)	missense	possibly damaging	0.72
R4677:Muc6	UTSW	7	141,224,212 (GRCm39)	intron	probably benign
R4678:Muc6	UTSW	7	141,230,554 (GRCm39)	missense	probably benign	0.09
R4737:Muc6	UTSW	7	141,218,685 (GRCm39)	missense	possibly damaging	0.72
R4737:Muc6	UTSW	7	141,226,426 (GRCm39)	intron	probably benign
R4981:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R5008:Muc6	UTSW	7	141,223,981 (GRCm39)	intron	probably benign
R5012:Muc6	UTSW	7	141,216,570 (GRCm39)	missense	possibly damaging	0.96
R5017:Muc6	UTSW	7	141,226,795 (GRCm39)	missense	probably benign
R5027:Muc6	UTSW	7	141,216,349 (GRCm39)	missense	probably benign	0.01
R5058:Muc6	UTSW	7	141,230,491 (GRCm39)	missense	probably benign	0.01
R5069:Muc6	UTSW	7	141,237,564 (GRCm39)	missense	probably damaging	1.00
R5126:Muc6	UTSW	7	141,237,564 (GRCm39)	missense	probably damaging	1.00
R5168:Muc6	UTSW	7	141,223,981 (GRCm39)	intron	probably benign
R5179:Muc6	UTSW	7	141,218,685 (GRCm39)	missense	possibly damaging	0.72
R5198:Muc6	UTSW	7	141,218,685 (GRCm39)	missense	possibly damaging	0.72
R5262:Muc6	UTSW	7	141,237,375 (GRCm39)	missense	possibly damaging	0.78
R5381:Muc6	UTSW	7	141,217,836 (GRCm39)	missense	possibly damaging	0.86
R5454:Muc6	UTSW	7	141,235,078 (GRCm39)	missense	possibly damaging	0.61
R5467:Muc6	UTSW	7	141,216,448 (GRCm39)	missense	possibly damaging	0.53
R5540:Muc6	UTSW	7	141,235,850 (GRCm39)	critical splice donor site	probably null
R5800:Muc6	UTSW	7	141,226,690 (GRCm39)	splice site	probably benign
R5808:Muc6	UTSW	7	141,226,360 (GRCm39)	intron	probably benign
R5865:Muc6	UTSW	7	141,236,769 (GRCm39)	missense	probably damaging	0.97
R5919:Muc6	UTSW	7	141,227,837 (GRCm39)	missense	possibly damaging	0.56
R6024:Muc6	UTSW	7	141,227,841 (GRCm39)	missense	possibly damaging	0.53
R6064:Muc6	UTSW	7	141,234,640 (GRCm39)	missense	probably damaging	1.00
R6126:Muc6	UTSW	7	141,218,685 (GRCm39)	missense	possibly damaging	0.72
R6229:Muc6	UTSW	7	141,226,792 (GRCm39)	missense	probably benign
R6236:Muc6	UTSW	7	141,218,685 (GRCm39)	missense	possibly damaging	0.72
R6245:Muc6	UTSW	7	141,235,086 (GRCm39)	missense	probably damaging	1.00
R6254:Muc6	UTSW	7	141,237,380 (GRCm39)	missense	probably benign	0.09
R6418:Muc6	UTSW	7	141,224,032 (GRCm39)	intron	probably benign
R6609:Muc6	UTSW	7	141,226,700 (GRCm39)	splice site	probably benign
R6610:Muc6	UTSW	7	141,226,700 (GRCm39)	splice site	probably benign
R6611:Muc6	UTSW	7	141,226,700 (GRCm39)	splice site	probably benign
R6623:Muc6	UTSW	7	141,223,981 (GRCm39)	intron	probably benign
R6626:Muc6	UTSW	7	141,223,981 (GRCm39)	intron	probably benign
R6817:Muc6	UTSW	7	141,237,326 (GRCm39)	missense	probably damaging	0.99
R6923:Muc6	UTSW	7	141,217,453 (GRCm39)	missense	possibly damaging	0.91
R6989:Muc6	UTSW	7	141,226,246 (GRCm39)	intron	probably benign
R7046:Muc6	UTSW	7	141,226,456 (GRCm39)	intron	probably benign
R7097:Muc6	UTSW	7	141,214,363 (GRCm39)	frame shift	probably null
R7099:Muc6	UTSW	7	141,214,363 (GRCm39)	frame shift	probably null
R7101:Muc6	UTSW	7	141,214,363 (GRCm39)	frame shift	probably null
R7107:Muc6	UTSW	7	141,214,363 (GRCm39)	frame shift	probably null
R7108:Muc6	UTSW	7	141,214,363 (GRCm39)	frame shift	probably null
R7112:Muc6	UTSW	7	141,235,542 (GRCm39)	missense	probably damaging	1.00
R7202:Muc6	UTSW	7	141,214,363 (GRCm39)	frame shift	probably null
R7204:Muc6	UTSW	7	141,214,363 (GRCm39)	frame shift	probably null
R7205:Muc6	UTSW	7	141,214,363 (GRCm39)	frame shift	probably null
R7222:Muc6	UTSW	7	141,214,428 (GRCm39)	missense	unknown
R7230:Muc6	UTSW	7	141,235,479 (GRCm39)	missense	probably damaging	1.00
R7278:Muc6	UTSW	7	141,226,842 (GRCm39)	missense	probably benign	0.09
R7483:Muc6	UTSW	7	141,224,245 (GRCm39)	missense	unknown
R7501:Muc6	UTSW	7	141,217,659 (GRCm39)	missense	probably damaging	0.98
R7601:Muc6	UTSW	7	141,216,454 (GRCm39)	missense	unknown
R7641:Muc6	UTSW	7	141,224,247 (GRCm39)	missense	unknown
R7644:Muc6	UTSW	7	141,217,659 (GRCm39)	missense	probably damaging	0.98
R7645:Muc6	UTSW	7	141,234,923 (GRCm39)	missense	probably benign	0.40
R7659:Muc6	UTSW	7	141,216,973 (GRCm39)	missense	possibly damaging	0.53
R7674:Muc6	UTSW	7	141,224,247 (GRCm39)	missense	unknown
R7679:Muc6	UTSW	7	141,217,659 (GRCm39)	missense	probably damaging	0.98
R7680:Muc6	UTSW	7	141,217,659 (GRCm39)	missense	probably damaging	0.98
R7689:Muc6	UTSW	7	141,217,659 (GRCm39)	missense	probably damaging	0.98
R7690:Muc6	UTSW	7	141,217,659 (GRCm39)	missense	probably damaging	0.98
R7760:Muc6	UTSW	7	141,237,322 (GRCm39)	splice site	probably null
R7806:Muc6	UTSW	7	141,217,387 (GRCm39)	missense	possibly damaging	0.53
R7809:Muc6	UTSW	7	141,226,638 (GRCm39)	missense	probably benign	0.02
R7848:Muc6	UTSW	7	141,232,188 (GRCm39)	missense	possibly damaging	0.53
R7859:Muc6	UTSW	7	141,231,687 (GRCm39)	missense	probably damaging	0.96
R8054:Muc6	UTSW	7	141,231,748 (GRCm39)	missense	probably damaging	1.00
R8085:Muc6	UTSW	7	141,226,729 (GRCm39)	missense	unknown
R8130:Muc6	UTSW	7	141,233,354 (GRCm39)	missense	probably damaging	0.97
R8210:Muc6	UTSW	7	141,235,673 (GRCm39)	critical splice donor site	probably null
R8273:Muc6	UTSW	7	141,226,795 (GRCm39)	missense	unknown
R8294:Muc6	UTSW	7	141,217,263 (GRCm39)	missense	possibly damaging	0.96
R8329:Muc6	UTSW	7	141,226,525 (GRCm39)	missense	unknown
R8379:Muc6	UTSW	7	141,230,579 (GRCm39)	nonsense	probably null
R8537:Muc6	UTSW	7	141,234,184 (GRCm39)	missense	probably benign	0.03
R8736:Muc6	UTSW	7	141,228,439 (GRCm39)	missense	possibly damaging	0.53
R8767:Muc6	UTSW	7	141,229,549 (GRCm39)	missense	probably damaging	1.00
R8902:Muc6	UTSW	7	141,233,791 (GRCm39)	missense	possibly damaging	0.93
R9009:Muc6	UTSW	7	141,217,018 (GRCm39)	missense	possibly damaging	0.73
R9010:Muc6	UTSW	7	141,226,351 (GRCm39)	missense	unknown
R9023:Muc6	UTSW	7	141,237,432 (GRCm39)	nonsense	probably null
R9058:Muc6	UTSW	7	141,218,154 (GRCm39)	missense	possibly damaging	0.61
R9257:Muc6	UTSW	7	141,226,738 (GRCm39)	missense	unknown
R9495:Muc6	UTSW	7	141,237,398 (GRCm39)	missense	probably damaging	0.98
R9563:Muc6	UTSW	7	141,217,783 (GRCm39)	missense	possibly damaging	0.53
R9645:Muc6	UTSW	7	141,217,783 (GRCm39)	missense	possibly damaging	0.53
R9659:Muc6	UTSW	7	141,232,100 (GRCm39)	missense	probably damaging	1.00
R9733:Muc6	UTSW	7	141,216,310 (GRCm39)	missense	unknown
R9787:Muc6	UTSW	7	141,227,748 (GRCm39)	nonsense	probably null
R9788:Muc6	UTSW	7	141,232,100 (GRCm39)	missense	probably damaging	1.00
V7581:Muc6	UTSW	7	141,233,880 (GRCm39)	missense	probably benign	0.11
V7583:Muc6	UTSW	7	141,233,880 (GRCm39)	missense	probably benign	0.11
X0026:Muc6	UTSW	7	141,237,964 (GRCm39)	missense	possibly damaging	0.94
X0058:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
Z1177:Muc6	UTSW	7	141,237,656 (GRCm39)	missense	probably benign	0.20
Z1177:Muc6	UTSW	7	141,236,701 (GRCm39)	missense	probably benign	0.29
Z1177:Muc6	UTSW	7	141,217,827 (GRCm39)	missense	possibly damaging	0.72

Predicted Primers

PCR Primer
(F):5'- TGTCCTAGAGATGGCAGCAG -3'
(R):5'- TTAGTCACATCACTGCCACC -3'

Sequencing Primer
(F):5'- CTGAGGACTGCTAGTTGTGCC -3'
(R):5'- AGTCACATCACTGCCACCATTCTC -3'

Posted On

2019-05-13