Incidental Mutation 'R0608:Spire1'
ID 54456
Institutional Source Beutler Lab
Gene Symbol Spire1
Ensembl Gene ENSMUSG00000024533
Gene Name spire type actin nucleation factor 1
Synonyms 6030430B19Rik, Spir-1
MMRRC Submission 038797-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.262) question?
Stock # R0608 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 67621279-67743860 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 67661945 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 163 (R163G)
Ref Sequence ENSEMBL: ENSMUSP00000049336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045105] [ENSMUST00000082243] [ENSMUST00000115050] [ENSMUST00000224799]
AlphaFold Q52KF3
Predicted Effect probably damaging
Transcript: ENSMUST00000045105
AA Change: R163G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000049336
Gene: ENSMUSG00000024533
AA Change: R163G

DomainStartEndE-ValueType
Pfam:KIND 1 78 3.3e-27 PFAM
PDB:4EFH|B 176 232 9e-6 PDB
low complexity region 289 316 N/A INTRINSIC
low complexity region 339 350 N/A INTRINSIC
SCOP:d1zbdb_ 445 518 1e-7 SMART
low complexity region 596 606 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000082243
AA Change: R163G

PolyPhen 2 Score 0.577 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000080871
Gene: ENSMUSG00000024533
AA Change: R163G

DomainStartEndE-ValueType
Blast:KIND 1 73 2e-26 BLAST
PDB:3RBW|D 1 79 3e-28 PDB
PDB:4EFH|B 176 232 9e-6 PDB
low complexity region 302 329 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
SCOP:d1zbdb_ 400 473 2e-7 SMART
low complexity region 551 561 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115050
AA Change: R163G

PolyPhen 2 Score 0.577 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110702
Gene: ENSMUSG00000024533
AA Change: R163G

DomainStartEndE-ValueType
PDB:4EFH|B 106 162 9e-6 PDB
low complexity region 219 246 N/A INTRINSIC
low complexity region 269 280 N/A INTRINSIC
SCOP:d1zbdb_ 317 390 4e-7 SMART
low complexity region 468 478 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000224799
AA Change: R93G

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spire proteins, such as SPIRE1, are highly conserved between species. They belong to the family of Wiskott-Aldrich homology region-2 (WH2) proteins, which are involved in actin organization (Kerkhoff et al., 2001 [PubMed 11747823]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile with normal brain anatomy and intact visual and motor functions in both sexes, but show a male-specific increase in contextual and cued fear memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 A G 14: 78,748,193 (GRCm39) V1398A probably benign Het
Ampd3 C A 7: 110,394,997 (GRCm39) D315E probably damaging Het
Ampd3 T A 7: 110,394,998 (GRCm39) F316I probably damaging Het
Arhgef40 A C 14: 52,234,431 (GRCm39) E911D probably damaging Het
Atxn2l A G 7: 126,100,588 (GRCm39) probably null Het
Bckdhb T G 9: 83,835,789 (GRCm39) F98V probably damaging Het
Calhm1 C T 19: 47,132,280 (GRCm39) V112I probably benign Het
Ccdc28a G A 10: 18,100,699 (GRCm39) R90C probably damaging Het
Cdc40 A T 10: 40,724,048 (GRCm39) Y247N probably benign Het
Cds1 G A 5: 101,962,299 (GRCm39) V305M probably damaging Het
Cep128 T G 12: 90,966,309 (GRCm39) probably benign Het
Cep72 A T 13: 74,186,423 (GRCm39) H249Q probably damaging Het
Cfap70 A T 14: 20,498,631 (GRCm39) Y19N probably damaging Het
Col11a1 T C 3: 114,012,364 (GRCm39) probably benign Het
Cstdc6 T C 16: 36,143,386 (GRCm39) probably null Het
Cysltr1 A G X: 105,622,261 (GRCm39) V75A possibly damaging Het
Dnaaf11 T A 15: 66,252,323 (GRCm39) M448L probably benign Het
Dnah17 G T 11: 117,981,575 (GRCm39) Y1716* probably null Het
Dnm1 T C 2: 32,225,836 (GRCm39) E383G possibly damaging Het
Dst C A 1: 34,329,437 (GRCm39) probably null Het
Edil3 T C 13: 89,332,968 (GRCm39) S375P probably damaging Het
Eme1 A G 11: 94,540,908 (GRCm39) C277R probably damaging Het
Enam T C 5: 88,640,886 (GRCm39) W183R possibly damaging Het
Fbxl6 C T 15: 76,420,953 (GRCm39) V341M probably benign Het
Fgf14 A G 14: 124,914,015 (GRCm39) S39P probably damaging Het
Fmo4 C T 1: 162,631,220 (GRCm39) R249H possibly damaging Het
Gle1 T A 2: 29,830,240 (GRCm39) D265E probably benign Het
Gml2 T C 15: 74,693,235 (GRCm39) probably null Het
Golgb1 G T 16: 36,736,692 (GRCm39) E1980* probably null Het
Hap1 A G 11: 100,240,131 (GRCm39) L555P probably damaging Het
Heca T C 10: 17,791,039 (GRCm39) D339G possibly damaging Het
Hepacam2 T C 6: 3,483,479 (GRCm39) T101A possibly damaging Het
Ift88 T C 14: 57,733,678 (GRCm39) V707A probably benign Het
Kdm3a C T 6: 71,597,030 (GRCm39) G252D probably benign Het
Klhl11 A G 11: 100,363,068 (GRCm39) Y163H probably damaging Het
Kntc1 A T 5: 123,924,137 (GRCm39) N1008Y probably damaging Het
Lrp2 G T 2: 69,316,587 (GRCm39) N2131K probably benign Het
Magi3 C G 3: 103,924,873 (GRCm39) G1092A probably damaging Het
Mef2a G T 7: 66,884,896 (GRCm39) S406* probably null Het
Minar2 A G 18: 59,195,531 (GRCm39) probably null Het
Mrps26 G T 2: 130,405,778 (GRCm39) R27L possibly damaging Het
Myof T C 19: 37,904,952 (GRCm39) D1624G probably damaging Het
Naif1 T C 2: 32,344,908 (GRCm39) M204T probably benign Het
Ndufb8 T C 19: 44,538,784 (GRCm39) E179G possibly damaging Het
Neb A T 2: 52,216,769 (GRCm39) D135E probably benign Het
Nlrp6 C T 7: 140,503,399 (GRCm39) Q502* probably null Het
Nploc4 A G 11: 120,304,507 (GRCm39) L238P probably damaging Het
Obi1 T C 14: 104,716,963 (GRCm39) Y470C probably damaging Het
Or4d2 G A 11: 87,784,022 (GRCm39) H243Y probably damaging Het
Parp4 T A 14: 56,839,861 (GRCm39) V523E probably damaging Het
Pdgfra T C 5: 75,324,438 (GRCm39) Y98H probably damaging Het
Plcz1 C T 6: 139,936,459 (GRCm39) R590H probably damaging Het
Pnliprp1 T A 19: 58,726,628 (GRCm39) Y328* probably null Het
Pnpla8 C T 12: 44,330,246 (GRCm39) P48L probably benign Het
Rab44 T A 17: 29,366,317 (GRCm39) probably null Het
Ranbp2 T C 10: 58,329,720 (GRCm39) I3031T probably damaging Het
Sbno1 T C 5: 124,522,604 (GRCm39) D1072G probably damaging Het
Senp7 A G 16: 55,944,236 (GRCm39) T187A possibly damaging Het
Serpinh1 A G 7: 98,998,601 (GRCm39) C10R unknown Het
Sh2d4a A G 8: 68,799,346 (GRCm39) Y405C possibly damaging Het
Slc26a7 T C 4: 14,621,317 (GRCm39) D23G probably benign Het
Slc7a7 A G 14: 54,615,259 (GRCm39) L246P probably damaging Het
Stxbp2 T A 8: 3,682,559 (GRCm39) D49E probably damaging Het
Susd2 C T 10: 75,474,069 (GRCm39) A509T probably benign Het
Sycp2 A G 2: 178,024,197 (GRCm39) F396L probably damaging Het
Syne2 T C 12: 76,010,587 (GRCm39) L2499P probably damaging Het
Syt10 C A 15: 89,711,144 (GRCm39) A130S probably benign Het
Sytl4 A T X: 132,862,936 (GRCm39) D16E probably benign Het
Tab2 C T 10: 7,795,883 (GRCm39) V126I probably damaging Het
Tecpr1 T C 5: 144,148,317 (GRCm39) T363A probably damaging Het
Terb2 A G 2: 122,016,816 (GRCm39) D16G probably benign Het
Tm2d2 A G 8: 25,510,552 (GRCm39) E137G probably benign Het
Trim30d T A 7: 104,121,692 (GRCm39) H201L probably damaging Het
Tspan3 A G 9: 56,054,669 (GRCm39) probably null Het
Ttn A T 2: 76,617,667 (GRCm39) L16268Q probably damaging Het
Ttn A T 2: 76,626,529 (GRCm39) probably null Het
Ubap2 T A 4: 41,218,319 (GRCm39) T263S probably benign Het
Vmn2r100 C A 17: 19,742,382 (GRCm39) P252Q possibly damaging Het
Zeb2 A T 2: 44,886,138 (GRCm39) M973K possibly damaging Het
Zfp229 A G 17: 21,965,615 (GRCm39) E615G probably damaging Het
Zfp655 T A 5: 145,180,867 (GRCm39) S242T possibly damaging Het
Zfp788 T A 7: 41,297,705 (GRCm39) F62I possibly damaging Het
Zmynd8 A G 2: 165,629,078 (GRCm39) probably null Het
Other mutations in Spire1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Spire1 APN 18 67,662,085 (GRCm39) missense probably damaging 1.00
IGL01639:Spire1 APN 18 67,678,738 (GRCm39) missense possibly damaging 0.74
IGL02334:Spire1 APN 18 67,639,725 (GRCm39) missense probably benign 0.00
PIT4677001:Spire1 UTSW 18 67,624,435 (GRCm39) missense probably damaging 1.00
R0457:Spire1 UTSW 18 67,685,670 (GRCm39) missense probably damaging 0.98
R0531:Spire1 UTSW 18 67,624,375 (GRCm39) missense probably damaging 1.00
R2098:Spire1 UTSW 18 67,636,536 (GRCm39) missense probably damaging 0.99
R2299:Spire1 UTSW 18 67,663,493 (GRCm39) missense probably damaging 1.00
R3028:Spire1 UTSW 18 67,624,417 (GRCm39) missense probably damaging 1.00
R3815:Spire1 UTSW 18 67,639,733 (GRCm39) missense probably benign 0.05
R4049:Spire1 UTSW 18 67,662,101 (GRCm39) splice site probably null
R4050:Spire1 UTSW 18 67,662,101 (GRCm39) splice site probably null
R4059:Spire1 UTSW 18 67,678,783 (GRCm39) missense probably damaging 0.98
R4109:Spire1 UTSW 18 67,630,287 (GRCm39) missense probably damaging 1.00
R4700:Spire1 UTSW 18 67,645,935 (GRCm39) missense probably benign 0.01
R4941:Spire1 UTSW 18 67,652,384 (GRCm39) missense possibly damaging 0.54
R4995:Spire1 UTSW 18 67,685,849 (GRCm39) splice site probably null
R5363:Spire1 UTSW 18 67,639,625 (GRCm39) missense probably damaging 1.00
R5561:Spire1 UTSW 18 67,639,716 (GRCm39) missense probably damaging 0.96
R5795:Spire1 UTSW 18 67,628,265 (GRCm39) missense probably benign
R5952:Spire1 UTSW 18 67,639,779 (GRCm39) missense probably benign 0.00
R5982:Spire1 UTSW 18 67,630,386 (GRCm39) critical splice acceptor site probably null
R7388:Spire1 UTSW 18 67,652,950 (GRCm39) missense probably damaging 1.00
R7559:Spire1 UTSW 18 67,634,187 (GRCm39) missense probably benign 0.04
R8006:Spire1 UTSW 18 67,634,251 (GRCm39) nonsense probably null
R8111:Spire1 UTSW 18 67,652,391 (GRCm39) missense probably damaging 0.98
R8675:Spire1 UTSW 18 67,624,378 (GRCm39) missense possibly damaging 0.48
R8946:Spire1 UTSW 18 67,629,686 (GRCm39) missense probably damaging 1.00
R9441:Spire1 UTSW 18 67,652,462 (GRCm39) missense probably benign 0.41
R9706:Spire1 UTSW 18 67,636,508 (GRCm39) missense probably benign 0.39
T0970:Spire1 UTSW 18 67,634,133 (GRCm39) splice site probably null
Z1088:Spire1 UTSW 18 67,628,222 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- ACTTTGCACAAGGGCTTCCCTG -3'
(R):5'- CCGGTTCTGGGTACAAGTGATGAG -3'

Sequencing Primer
(F):5'- caggaggcagagggagag -3'
(R):5'- GTACAAGTGATGAGGGATTTGC -3'
Posted On 2013-07-11