Mutagenetix > Incidental Mutation

Incidental Mutation 'R0608:Spire1'

54456

Institutional Source

Beutler Lab

Gene Symbol

Spire1

Ensembl Gene

ENSMUSG00000024533

Gene Name

spire type actin nucleation factor 1

Synonyms

6030430B19Rik, Spir-1

MMRRC Submission

038797-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.301) question?

Stock #

R0608 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

67488209-67610790 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 67528875 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 163 (R163G)

Ref Sequence

ENSEMBL: ENSMUSP00000049336 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045105] [ENSMUST00000082243] [ENSMUST00000115050] [ENSMUST00000224799]

AlphaFold

Q52KF3

Predicted Effect

probably damaging
Transcript: ENSMUST00000045105
AA Change: R163G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000049336
Gene: ENSMUSG00000024533
AA Change: R163G

Domain	Start	End	E-Value	Type
Pfam:KIND	1	78	3.3e-27	PFAM
PDB:4EFH\|B	176	232	9e-6	PDB
low complexity region	289	316	N/A	INTRINSIC
low complexity region	339	350	N/A	INTRINSIC
SCOP:d1zbdb_	445	518	1e-7	SMART
low complexity region	596	606	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000082243
AA Change: R163G

PolyPhen 2 Score 0.577 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000080871
Gene: ENSMUSG00000024533
AA Change: R163G

Domain	Start	End	E-Value	Type
Blast:KIND	1	73	2e-26	BLAST
PDB:3RBW\|D	1	79	3e-28	PDB
PDB:4EFH\|B	176	232	9e-6	PDB
low complexity region	302	329	N/A	INTRINSIC
low complexity region	352	363	N/A	INTRINSIC
SCOP:d1zbdb_	400	473	2e-7	SMART
low complexity region	551	561	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115050
AA Change: R163G

PolyPhen 2 Score 0.577 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000110702
Gene: ENSMUSG00000024533
AA Change: R163G

Domain	Start	End	E-Value	Type
PDB:4EFH\|B	106	162	9e-6	PDB
low complexity region	219	246	N/A	INTRINSIC
low complexity region	269	280	N/A	INTRINSIC
SCOP:d1zbdb_	317	390	4e-7	SMART
low complexity region	468	478	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000224799
AA Change: R93G

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)

Coding Region Coverage

1x: 99.4%
3x: 99.0%
10x: 97.7%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spire proteins, such as SPIRE1, are highly conserved between species. They belong to the family of Wiskott-Aldrich homology region-2 (WH2) proteins, which are involved in actin organization (Kerkhoff et al., 2001 [PubMed 11747823]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile with normal brain anatomy and intact visual and motor functions in both sexes, but show a male-specific increase in contextual and cued fear memory. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A730017C20Rik	A	G	18: 59,062,459		probably null	Het
Akap11	A	G	14: 78,510,753	V1398A	probably benign	Het
Ampd3	C	A	7: 110,795,790	D315E	probably damaging	Het
Ampd3	T	A	7: 110,795,791	F316I	probably damaging	Het
Arhgef40	A	C	14: 51,996,974	E911D	probably damaging	Het
Atxn2l	A	G	7: 126,501,416		probably null	Het
BC117090	T	C	16: 36,323,024		probably null	Het
Bckdhb	T	G	9: 83,953,736	F98V	probably damaging	Het
Calhm1	C	T	19: 47,143,841	V112I	probably benign	Het
Ccdc28a	G	A	10: 18,224,951	R90C	probably damaging	Het
Cdc40	A	T	10: 40,848,052	Y247N	probably benign	Het
Cds1	G	A	5: 101,814,433	V305M	probably damaging	Het
Cep128	T	G	12: 90,999,535		probably benign	Het
Cep72	A	T	13: 74,038,304	H249Q	probably damaging	Het
Cfap70	A	T	14: 20,448,563	Y19N	probably damaging	Het
Col11a1	T	C	3: 114,218,715		probably benign	Het
Cysltr1	A	G	X: 106,578,655	V75A	possibly damaging	Het
Dnah17	G	T	11: 118,090,749	Y1716*	probably null	Het
Dnm1	T	C	2: 32,335,824	E383G	possibly damaging	Het
Dst	C	A	1: 34,290,356		probably null	Het
Edil3	T	C	13: 89,184,849	S375P	probably damaging	Het
Eme1	A	G	11: 94,650,082	C277R	probably damaging	Het
Enam	T	C	5: 88,493,027	W183R	possibly damaging	Het
Fbxl6	C	T	15: 76,536,753	V341M	probably benign	Het
Fgf14	A	G	14: 124,676,603	S39P	probably damaging	Het
Fmo4	C	T	1: 162,803,651	R249H	possibly damaging	Het
Gle1	T	A	2: 29,940,228	D265E	probably benign	Het
Gml2	T	C	15: 74,821,386		probably null	Het
Golgb1	G	T	16: 36,916,330	E1980*	probably null	Het
Hap1	A	G	11: 100,349,305	L555P	probably damaging	Het
Heca	T	C	10: 17,915,291	D339G	possibly damaging	Het
Hepacam2	T	C	6: 3,483,479	T101A	possibly damaging	Het
Ift88	T	C	14: 57,496,221	V707A	probably benign	Het
Kdm3a	C	T	6: 71,620,046	G252D	probably benign	Het
Klhl11	A	G	11: 100,472,242	Y163H	probably damaging	Het
Kntc1	A	T	5: 123,786,074	N1008Y	probably damaging	Het
Lrp2	G	T	2: 69,486,243	N2131K	probably benign	Het
Lrrc6	T	A	15: 66,380,474	M448L	probably benign	Het
Magi3	C	G	3: 104,017,557	G1092A	probably damaging	Het
Mef2a	G	T	7: 67,235,148	S406*	probably null	Het
Mrps26	G	T	2: 130,563,858	R27L	possibly damaging	Het
Myof	T	C	19: 37,916,504	D1624G	probably damaging	Het
Naif1	T	C	2: 32,454,896	M204T	probably benign	Het
Ndufb8	T	C	19: 44,550,345	E179G	possibly damaging	Het
Neb	A	T	2: 52,326,757	D135E	probably benign	Het
Nlrp6	C	T	7: 140,923,486	Q502*	probably null	Het
Nploc4	A	G	11: 120,413,681	L238P	probably damaging	Het
Olfr463	G	A	11: 87,893,196	H243Y	probably damaging	Het
Parp4	T	A	14: 56,602,404	V523E	probably damaging	Het
Pdgfra	T	C	5: 75,163,777	Y98H	probably damaging	Het
Plcz1	C	T	6: 139,990,733	R590H	probably damaging	Het
Pnliprp1	T	A	19: 58,738,196	Y328*	probably null	Het
Pnpla8	C	T	12: 44,283,463	P48L	probably benign	Het
Rab44	T	A	17: 29,147,343		probably null	Het
Ranbp2	T	C	10: 58,493,898	I3031T	probably damaging	Het
Rnf219	T	C	14: 104,479,527	Y470C	probably damaging	Het
Sbno1	T	C	5: 124,384,541	D1072G	probably damaging	Het
Senp7	A	G	16: 56,123,873	T187A	possibly damaging	Het
Serpinh1	A	G	7: 99,349,394	C10R	unknown	Het
Sh2d4a	A	G	8: 68,346,694	Y405C	possibly damaging	Het
Slc26a7	T	C	4: 14,621,317	D23G	probably benign	Het
Slc7a7	A	G	14: 54,377,802	L246P	probably damaging	Het
Stxbp2	T	A	8: 3,632,559	D49E	probably damaging	Het
Susd2	C	T	10: 75,638,235	A509T	probably benign	Het
Sycp2	A	G	2: 178,382,404	F396L	probably damaging	Het
Syne2	T	C	12: 75,963,813	L2499P	probably damaging	Het
Syt10	C	A	15: 89,826,941	A130S	probably benign	Het
Sytl4	A	T	X: 133,962,187	D16E	probably benign	Het
Tab2	C	T	10: 7,920,119	V126I	probably damaging	Het
Tecpr1	T	C	5: 144,211,499	T363A	probably damaging	Het
Terb2	A	G	2: 122,186,335	D16G	probably benign	Het
Tm2d2	A	G	8: 25,020,536	E137G	probably benign	Het
Trim30d	T	A	7: 104,472,485	H201L	probably damaging	Het
Tspan3	A	G	9: 56,147,385		probably null	Het
Ttn	A	T	2: 76,787,323	L16268Q	probably damaging	Het
Ttn	A	T	2: 76,796,185		probably null	Het
Ubap2	T	A	4: 41,218,319	T263S	probably benign	Het
Vmn2r100	C	A	17: 19,522,120	P252Q	possibly damaging	Het
Zeb2	A	T	2: 44,996,126	M973K	possibly damaging	Het
Zfp229	A	G	17: 21,746,634	E615G	probably damaging	Het
Zfp655	T	A	5: 145,244,057	S242T	possibly damaging	Het
Zfp788	T	A	7: 41,648,281	F62I	possibly damaging	Het
Zmynd8	A	G	2: 165,787,158		probably null	Het

Other mutations in Spire1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00423:Spire1	APN	18	67529015	missense	probably damaging	1.00
IGL01639:Spire1	APN	18	67545668	missense	possibly damaging	0.74
IGL02334:Spire1	APN	18	67506655	missense	probably benign	0.00
PIT4677001:Spire1	UTSW	18	67491365	missense	probably damaging	1.00
R0457:Spire1	UTSW	18	67552600	missense	probably damaging	0.98
R0531:Spire1	UTSW	18	67491305	missense	probably damaging	1.00
R2098:Spire1	UTSW	18	67503466	missense	probably damaging	0.99
R2299:Spire1	UTSW	18	67530423	missense	probably damaging	1.00
R3028:Spire1	UTSW	18	67491347	missense	probably damaging	1.00
R3815:Spire1	UTSW	18	67506663	missense	probably benign	0.05
R4049:Spire1	UTSW	18	67529031	splice site	probably null
R4050:Spire1	UTSW	18	67529031	splice site	probably null
R4059:Spire1	UTSW	18	67545713	missense	probably damaging	0.98
R4109:Spire1	UTSW	18	67497217	missense	probably damaging	1.00
R4700:Spire1	UTSW	18	67512865	missense	probably benign	0.01
R4941:Spire1	UTSW	18	67519314	missense	possibly damaging	0.54
R4995:Spire1	UTSW	18	67552779	splice site	probably null
R5363:Spire1	UTSW	18	67506555	missense	probably damaging	1.00
R5561:Spire1	UTSW	18	67506646	missense	probably damaging	0.96
R5795:Spire1	UTSW	18	67495195	missense	probably benign
R5952:Spire1	UTSW	18	67506709	missense	probably benign	0.00
R5982:Spire1	UTSW	18	67497316	critical splice acceptor site	probably null
R7388:Spire1	UTSW	18	67519880	missense	probably damaging	1.00
R7559:Spire1	UTSW	18	67501117	missense	probably benign	0.04
R8006:Spire1	UTSW	18	67501181	nonsense	probably null
R8111:Spire1	UTSW	18	67519321	missense	probably damaging	0.98
R8675:Spire1	UTSW	18	67491308	missense	possibly damaging	0.48
R8946:Spire1	UTSW	18	67496616	missense	probably damaging	1.00
R9441:Spire1	UTSW	18	67519392	missense	probably benign	0.41
R9706:Spire1	UTSW	18	67503438	missense	probably benign	0.39
T0970:Spire1	UTSW	18	67501063	splice site	probably null
Z1088:Spire1	UTSW	18	67495152	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- ACTTTGCACAAGGGCTTCCCTG -3'
(R):5'- CCGGTTCTGGGTACAAGTGATGAG -3'

Sequencing Primer
(F):5'- caggaggcagagggagag -3'
(R):5'- GTACAAGTGATGAGGGATTTGC -3'

Posted On

2013-07-11