Incidental Mutation 'R7001:N6amt1'
ID544566
Institutional Source Beutler Lab
Gene Symbol N6amt1
Ensembl Gene ENSMUSG00000044442
Gene NameN-6 adenine-specific DNA methyltransferase 1 (putative)
SynonymsHemk2, Pred28, 5830445C04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7001 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location87354185-87368742 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 87354292 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 14 (V14M)
Ref Sequence ENSEMBL: ENSMUSP00000112510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054442] [ENSMUST00000118115] [ENSMUST00000118310] [ENSMUST00000120284]
Predicted Effect probably benign
Transcript: ENSMUST00000054442
AA Change: V14M

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000061835
Gene: ENSMUSG00000044442
AA Change: V14M

DomainStartEndE-ValueType
Pfam:MTS 26 202 4.2e-12 PFAM
Pfam:Methyltransf_26 45 175 6.7e-15 PFAM
Pfam:Methyltransf_31 45 213 5.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118115
AA Change: V14M

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000113217
Gene: ENSMUSG00000044442
AA Change: V14M

DomainStartEndE-ValueType
Pfam:MTS 21 179 2e-14 PFAM
Pfam:Methyltransf_26 46 175 1.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118310
AA Change: V14M

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000113229
Gene: ENSMUSG00000044442
AA Change: V14M

DomainStartEndE-ValueType
Pfam:MTS 20 137 1.7e-12 PFAM
Pfam:PrmA 27 123 6.9e-7 PFAM
Pfam:Methyltransf_26 45 137 2.7e-13 PFAM
Pfam:Methyltransf_25 49 138 6.9e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120284
AA Change: V14M

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000112510
Gene: ENSMUSG00000044442
AA Change: V14M

DomainStartEndE-ValueType
Pfam:MTS 20 150 3.4e-12 PFAM
Pfam:PrmA 27 123 1.4e-6 PFAM
Pfam:Methyltransf_26 46 148 1.4e-12 PFAM
Pfam:Methyltransf_25 49 147 1.7e-7 PFAM
Meta Mutation Damage Score 0.1058 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an N(6)-adenine-specific DNA methyltransferase. The encoded enzyme may be involved in the methylation of release factor I during translation termination. This enzyme is also involved in converting the arsenic metabolite monomethylarsonous acid to the less toxic dimethylarsonic acid. Alternative splicing pf this gene results in multiple transcript variants. A related pseudogene has been identified on chromosome 11. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele fail to form a primitive streak and die between E7.5 and E9.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C A 3: 138,065,511 Q154K probably benign Het
Aldh6a1 T G 12: 84,441,888 T75P probably damaging Het
Ank2 T A 3: 127,077,581 H98L probably damaging Het
Ankib1 A G 5: 3,694,781 F800S probably benign Het
Arhgap10 A T 8: 77,365,088 M434K possibly damaging Het
Cap1 A T 4: 122,864,615 F257L probably benign Het
Cdt1 T A 8: 122,572,510 H510Q probably damaging Het
Clca3b A C 3: 144,827,972 D547E possibly damaging Het
Col24a1 T C 3: 145,298,866 V35A probably benign Het
Cyp2j13 A T 4: 96,056,875 N305K probably damaging Het
D3Ertd751e T A 3: 41,758,409 probably null Het
D6Ertd527e G A 6: 87,111,212 G119D unknown Het
Ddc T C 11: 11,824,870 probably null Het
Dnah12 A T 14: 26,879,724 Y3713F probably damaging Het
Dock8 T A 19: 25,099,677 S504T probably benign Het
Farp2 T C 1: 93,620,184 F941L possibly damaging Het
Farp2 A G 1: 93,620,230 N956S possibly damaging Het
Fbxo3 T A 2: 104,051,224 H300Q probably damaging Het
Fcgrt T C 7: 45,102,042 T131A probably benign Het
Fndc7 G A 3: 108,876,648 A215V probably benign Het
Frem1 T C 4: 82,986,561 E890G probably benign Het
Fsip2 C A 2: 82,986,925 P4334H probably damaging Het
Gcdh C A 8: 84,890,911 V227L probably benign Het
Gm8267 A C 14: 44,722,928 M120R possibly damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Lasp1 T G 11: 97,806,833 H26Q probably damaging Het
Lrrcc1 T A 3: 14,540,095 I297N probably damaging Het
Map1b A T 13: 99,430,593 N1873K unknown Het
Map2 A G 1: 66,415,487 I1179V probably benign Het
Mtss1 A C 15: 58,948,334 probably benign Het
Mtus2 A G 5: 148,277,628 E28G probably damaging Het
Muc6 G A 7: 141,637,407 T2386I probably damaging Het
Myo3a G T 2: 22,332,377 V362L probably benign Het
Nav1 A T 1: 135,454,611 probably null Het
Nol6 A G 4: 41,121,279 S326P probably benign Het
Olfr1084 A T 2: 86,639,151 S186T probably benign Het
Olfr599 A G 7: 103,338,221 S56G possibly damaging Het
Olr1 T A 6: 129,488,111 E100V probably damaging Het
Otop3 T C 11: 115,339,653 Y119H probably damaging Het
Prpmp5 C T 6: 132,312,564 G99E unknown Het
Ryr2 A T 13: 11,794,605 M778K probably damaging Het
Serpina3n G T 12: 104,408,925 M85I probably benign Het
Serpine2 A G 1: 79,795,031 F390L probably damaging Het
Sf3b1 A G 1: 55,001,046 V591A probably damaging Het
Sf3b1 A G 1: 55,014,481 probably null Het
Slc26a5 C T 5: 21,811,336 V646I probably damaging Het
Slitrk3 T A 3: 73,050,609 K277* probably null Het
Sv2c A G 13: 95,981,953 S463P probably benign Het
Tbc1d4 G A 14: 101,458,749 T858M probably benign Het
Tbx18 T A 9: 87,727,404 I193F probably damaging Het
Tm6sf2 A C 8: 70,078,332 D245A probably damaging Het
Unc119 T C 11: 78,348,554 Y234H probably damaging Het
Wrn A T 8: 33,352,129 S46T probably benign Het
Zfp729a A T 13: 67,620,349 I587K probably benign Het
Zfp872 C A 9: 22,200,616 H464N probably damaging Het
Other mutations in N6amt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1079:N6amt1 UTSW 16 87356198 missense probably damaging 0.98
R3028:N6amt1 UTSW 16 87362648 missense probably benign 0.00
R4692:N6amt1 UTSW 16 87356966 missense possibly damaging 0.65
R5324:N6amt1 UTSW 16 87354353 missense probably damaging 1.00
R5686:N6amt1 UTSW 16 87354335 missense probably damaging 1.00
R7223:N6amt1 UTSW 16 87362660 makesense probably null
R7419:N6amt1 UTSW 16 87367566 missense possibly damaging 0.63
R8084:N6amt1 UTSW 16 87354340 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGAAAACGGATGTTAGAGGTTGC -3'
(R):5'- TGTCAATCACCAGAAAGTAGGCC -3'

Sequencing Primer
(F):5'- GTTGCTTAAAAGTTCCAGAGAGCCC -3'
(R):5'- AGAAAGTAGGCCGGCCCAC -3'
Posted On2019-05-13